Incidental Mutation 'R3055:Radil'
ID334570
Institutional Source Beutler Lab
Gene Symbol Radil
Ensembl Gene ENSMUSG00000029576
Gene NameRas association and DIL domains
SynonymsD930005D10Rik
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3055 (G1)
Quality Score62
Status Validated
Chromosome5
Chromosomal Location142484839-142551098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142495406 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 549 (T549A)
Ref Sequence ENSEMBL: ENSMUSP00000106412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063635] [ENSMUST00000085758] [ENSMUST00000110784] [ENSMUST00000110785]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063635
AA Change: T549A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064539
Gene: ENSMUSG00000029576
AA Change: T549A

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 950 964 N/A INTRINSIC
PDZ 979 1056 3.86e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085758
AA Change: T578A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082910
Gene: ENSMUSG00000029576
AA Change: T578A

DomainStartEndE-ValueType
RA 90 193 1.68e-15 SMART
Blast:FHA 294 361 2e-25 BLAST
low complexity region 373 383 N/A INTRINSIC
low complexity region 579 589 N/A INTRINSIC
DIL 663 772 6.19e-34 SMART
low complexity region 979 993 N/A INTRINSIC
PDZ 1008 1085 3.86e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110784
AA Change: T309A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106411
Gene: ENSMUSG00000029576
AA Change: T309A

DomainStartEndE-ValueType
Blast:FHA 25 92 3e-25 BLAST
low complexity region 104 114 N/A INTRINSIC
low complexity region 310 320 N/A INTRINSIC
DIL 394 503 6.19e-34 SMART
low complexity region 710 724 N/A INTRINSIC
PDZ 739 816 3.86e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110785
AA Change: T549A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106412
Gene: ENSMUSG00000029576
AA Change: T549A

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 973 987 N/A INTRINSIC
PDZ 1002 1079 3.86e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139824
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Radil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Radil APN 5 142497922 missense probably damaging 0.99
IGL01359:Radil APN 5 142543713 missense probably damaging 0.98
IGL01714:Radil APN 5 142543397 unclassified probably benign
IGL02086:Radil APN 5 142543821 missense probably benign 0.28
IGL02250:Radil APN 5 142543774 missense probably damaging 1.00
IGL02296:Radil APN 5 142506463 missense probably benign 0.10
IGL02890:Radil APN 5 142543708 missense probably damaging 1.00
IGL02978:Radil APN 5 142494919 missense probably benign 0.00
IGL03131:Radil APN 5 142495342 missense probably damaging 1.00
R0362:Radil UTSW 5 142543827 missense probably benign 0.00
R0389:Radil UTSW 5 142543471 missense probably damaging 0.98
R0426:Radil UTSW 5 142497873 missense probably damaging 1.00
R1753:Radil UTSW 5 142495336 missense probably damaging 1.00
R2168:Radil UTSW 5 142506963 missense probably benign 0.00
R3177:Radil UTSW 5 142506856 missense probably damaging 1.00
R3277:Radil UTSW 5 142506856 missense probably damaging 1.00
R3851:Radil UTSW 5 142506997 missense probably damaging 1.00
R4043:Radil UTSW 5 142494233 missense probably benign 0.31
R4245:Radil UTSW 5 142543791 missense probably damaging 1.00
R4367:Radil UTSW 5 142494805 missense probably benign 0.06
R4697:Radil UTSW 5 142486801 missense probably benign
R4798:Radil UTSW 5 142485163 missense probably benign 0.39
R4948:Radil UTSW 5 142485239 missense probably benign 0.02
R5407:Radil UTSW 5 142508215 missense probably damaging 1.00
R5784:Radil UTSW 5 142487513 missense possibly damaging 0.88
R5918:Radil UTSW 5 142487602 missense probably benign 0.43
R5943:Radil UTSW 5 142485458 missense probably damaging 1.00
R6112:Radil UTSW 5 142543644 missense probably damaging 1.00
R6147:Radil UTSW 5 142497940 missense probably benign 0.01
R6174:Radil UTSW 5 142487115 missense probably benign
R6241:Radil UTSW 5 142494942 missense probably damaging 1.00
R6874:Radil UTSW 5 142506802 missense probably damaging 1.00
R6881:Radil UTSW 5 142486917 missense probably benign 0.00
R7056:Radil UTSW 5 142494354 nonsense probably null
R7134:Radil UTSW 5 142485549 missense probably damaging 1.00
R7167:Radil UTSW 5 142485505 splice site probably null
R7374:Radil UTSW 5 142485480 missense probably damaging 1.00
R7482:Radil UTSW 5 142486763 missense probably benign
R7607:Radil UTSW 5 142494795 missense probably damaging 0.98
R7607:Radil UTSW 5 142506613 missense probably damaging 0.99
R7777:Radil UTSW 5 142543548 missense probably damaging 1.00
R7779:Radil UTSW 5 142487565 missense probably benign 0.03
R8047:Radil UTSW 5 142494940 missense probably damaging 1.00
R8123:Radil UTSW 5 142487620 missense probably damaging 0.99
R8418:Radil UTSW 5 142494921 missense probably benign 0.23
R8525:Radil UTSW 5 142488501 missense probably damaging 1.00
R8708:Radil UTSW 5 142485449 missense probably damaging 1.00
R8827:Radil UTSW 5 142508104 missense probably damaging 1.00
X0058:Radil UTSW 5 142487514 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TACTAGGCTGGACCATGAAGGC -3'
(R):5'- CATACCAGATGGGAGTGTTGGC -3'

Sequencing Primer
(F):5'- TGGACCATGAAGGCATTCCTG -3'
(R):5'- TGGCGAGCCAGGCAGATC -3'
Posted On2015-09-03