Incidental Mutation 'R2874:Gm10717'
ID334573
Institutional Source Beutler Lab
Gene Symbol Gm10717
Ensembl Gene ENSMUSG00000095891
Gene Namepredicted gene 10717
Synonyms
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R2874 (G1)
Quality Score46
Status Validated
Chromosome9
Chromosomal Location3025417-3033289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3025532 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 39 (Y39C)
Ref Sequence ENSEMBL: ENSMUSP00000096644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075573] [ENSMUST00000099042] [ENSMUST00000099046] [ENSMUST00000099047] [ENSMUST00000099051] [ENSMUST00000177601] [ENSMUST00000177875] [ENSMUST00000179272] [ENSMUST00000179982]
Predicted Effect probably benign
Transcript: ENSMUST00000075573
AA Change: Y39C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096644
Gene: ENSMUSG00000095891
AA Change: Y39C

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.06e-10 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 177 1.06e-10 PROSPERO
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099042
SMART Domains Protein: ENSMUSP00000096640
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 47 9.09e-8 PROSPERO
transmembrane domain 76 98 N/A INTRINSIC
internal_repeat_1 117 164 9.09e-8 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099046
SMART Domains Protein: ENSMUSP00000096645
Gene: ENSMUSG00000095186

DomainStartEndE-ValueType
internal_repeat_1 1 41 4.44e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 177 4.44e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099047
SMART Domains Protein: ENSMUSP00000096646
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 40 1.58e-10 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 176 1.58e-10 PROSPERO
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099051
SMART Domains Protein: ENSMUSP00000096650
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 2 38 6.22e-5 PROSPERO
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
internal_repeat_1 118 174 6.22e-5 PROSPERO
transmembrane domain 185 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177601
SMART Domains Protein: ENSMUSP00000136755
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_2 1 24 2.26e-6 PROSPERO
internal_repeat_1 2 37 2.26e-6 PROSPERO
internal_repeat_1 40 95 2.26e-6 PROSPERO
internal_repeat_2 118 142 2.26e-6 PROSPERO
low complexity region 147 159 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177875
SMART Domains Protein: ENSMUSP00000137419
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.49e-11 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 186 1.49e-11 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179272
SMART Domains Protein: ENSMUSP00000136170
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.1e-10 PROSPERO
transmembrane domain 74 96 N/A INTRINSIC
internal_repeat_1 118 186 2.1e-10 PROSPERO
transmembrane domain 198 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179982
SMART Domains Protein: ENSMUSP00000136365
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 35 7.76e-13 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 152 7.76e-13 PROSPERO
low complexity region 157 169 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181957
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Gm10717
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Gm10717 APN 9 3025511 missense probably damaging 1.00
IGL01635:Gm10717 APN 9 3025506 missense possibly damaging 0.46
IGL01864:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01865:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01865:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01866:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01873:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01875:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01877:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01877:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01878:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01879:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01880:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01882:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01886:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01887:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01892:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01893:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01897:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01901:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01903:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01904:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01907:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01907:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01908:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01913:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01919:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01920:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01923:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01925:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01927:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01930:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01931:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01932:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01935:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01941:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01948:Gm10717 APN 9 3025819 missense probably damaging 1.00
IGL01949:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01951:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01952:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL02106:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02142:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL02592:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02609:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02802:Gm10717 UTSW 9 3031999 missense probably benign
R0277:Gm10717 UTSW 9 3025619 missense possibly damaging 0.79
R1813:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R1911:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R2399:Gm10717 UTSW 9 3025532 missense probably benign
R3617:Gm10717 UTSW 9 3025532 missense probably benign
R3720:Gm10717 UTSW 9 3025532 missense probably benign
R4988:Gm10717 UTSW 9 3026368 missense probably benign 0.00
R5002:Gm10717 UTSW 9 3025532 missense probably benign
R5117:Gm10717 UTSW 9 3025625 missense probably benign 0.00
R5367:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R5539:Gm10717 UTSW 9 3030438 missense probably damaging 1.00
R5623:Gm10717 UTSW 9 3026318 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGTGGACATTTCTAAATTTTCGAC -3'
(R):5'- AGAAATGCACACTGTAGGACCT -3'

Sequencing Primer
(F):5'- GCCATATTTCATGTCCCAAAGTGTG -3'
(R):5'- TGCACACTGTAGGACCTGGAATATG -3'
Posted On2015-09-04