Incidental Mutation 'R3052:Banp'
ID334577
Institutional Source Beutler Lab
Gene Symbol Banp
Ensembl Gene ENSMUSG00000025316
Gene NameBTG3 associated nuclear protein
SynonymsSMAR1
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R3052 (G1)
Quality Score32
Status Validated
Chromosome8
Chromosomal Location121949750-122029258 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 122005687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026354] [ENSMUST00000093078] [ENSMUST00000127664] [ENSMUST00000167711] [ENSMUST00000167711] [ENSMUST00000170857] [ENSMUST00000173254] [ENSMUST00000173254]
Predicted Effect probably null
Transcript: ENSMUST00000026354
SMART Domains Protein: ENSMUSP00000026354
Gene: ENSMUSG00000025316

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
BEN 218 291 6.7e-21 SMART
low complexity region 301 315 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093078
SMART Domains Protein: ENSMUSP00000090766
Gene: ENSMUSG00000025316

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
BEN 218 291 6.7e-21 SMART
low complexity region 301 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167711
SMART Domains Protein: ENSMUSP00000132434
Gene: ENSMUSG00000025316

DomainStartEndE-ValueType
BEN 72 145 6.7e-21 SMART
low complexity region 155 169 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167711
SMART Domains Protein: ENSMUSP00000132434
Gene: ENSMUSG00000025316

DomainStartEndE-ValueType
BEN 72 145 6.7e-21 SMART
low complexity region 155 169 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170857
SMART Domains Protein: ENSMUSP00000132095
Gene: ENSMUSG00000025316

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
BEN 257 330 6.7e-21 SMART
low complexity region 340 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173201
Predicted Effect probably null
Transcript: ENSMUST00000173254
SMART Domains Protein: ENSMUSP00000133783
Gene: ENSMUSG00000025316

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
BEN 257 330 6.7e-21 SMART
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173254
SMART Domains Protein: ENSMUSP00000133783
Gene: ENSMUSG00000025316

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
BEN 257 330 6.7e-21 SMART
low complexity region 340 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173925
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Banp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Banp APN 8 122007091 missense probably benign 0.02
IGL02981:Banp APN 8 121978564 missense possibly damaging 0.89
PIT4418001:Banp UTSW 8 122005626 missense probably damaging 1.00
R0926:Banp UTSW 8 122020555 missense probably benign
R1209:Banp UTSW 8 121975917 missense possibly damaging 0.79
R1635:Banp UTSW 8 122001011 missense probably damaging 1.00
R2229:Banp UTSW 8 121978685 missense probably damaging 0.99
R2269:Banp UTSW 8 121975923 missense probably benign 0.01
R5155:Banp UTSW 8 122001020 missense probably damaging 1.00
R5554:Banp UTSW 8 121991595 missense probably damaging 1.00
R6479:Banp UTSW 8 121991437 unclassified probably null
R7376:Banp UTSW 8 121974497 missense probably damaging 0.99
R7468:Banp UTSW 8 121949849 critical splice donor site probably null
R7646:Banp UTSW 8 122024036 missense possibly damaging 0.94
R7702:Banp UTSW 8 121978587 nonsense probably null
R7832:Banp UTSW 8 122020552 missense probably benign
R7915:Banp UTSW 8 122020552 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCCAAGATGACAGGTGTC -3'
(R):5'- TGTTGCCTTTAAAACAGCCC -3'

Sequencing Primer
(F):5'- ACAGGTGTCATTCACTCTGTG -3'
(R):5'- TTGAGCAGCTTCTGAGGT -3'
Posted On2015-09-10