Incidental Mutation 'R3436:Ehd1'
ID 334582
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene Name EH-domain containing 1
Synonyms RME-1, Past1
MMRRC Submission 040654-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3436 (G1)
Quality Score 77
Status Validated
Chromosome 19
Chromosomal Location 6276725-6300096 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 6277014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 14 (E14*)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
AlphaFold Q9WVK4
Predicted Effect probably null
Transcript: ENSMUST00000025684
AA Change: E14*
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: E14*

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165797
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambp T C 4: 63,149,484 E163G probably benign Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Cadps A T 14: 12,616,158 probably null Het
Ccdc146 A G 5: 21,297,005 S804P possibly damaging Het
Cdc20b T C 13: 113,078,699 I267T probably damaging Het
Cdh8 A G 8: 99,400,718 probably benign Het
Dse G T 10: 34,152,474 N873K probably benign Het
F8 A G X: 75,267,424 probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Fndc1 T C 17: 7,750,357 K1559E probably damaging Het
Ighg1 T C 12: 113,329,560 E170G probably damaging Het
Kmt2b G T 7: 30,576,692 P1794Q probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1189 T A 2: 88,592,104 F100Y probably damaging Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr138 G A 17: 38,275,530 G253D probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Pkd1l2 T C 8: 117,040,739 N1271D probably benign Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Prr16 A G 18: 51,303,123 N225D probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Sort1 T A 3: 108,337,807 I325N probably damaging Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Tmprss11b A T 5: 86,667,584 Y48* probably null Het
Tpp2 T C 1: 43,940,144 I67T probably damaging Het
Trdn G A 10: 33,468,195 probably null Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Trim17 T C 11: 58,965,233 C39R probably damaging Het
Trim52 C T 14: 106,107,307 P133L possibly damaging Het
Unc13b T C 4: 43,097,028 probably benign Het
Vmn2r94 G A 17: 18,258,388 probably benign Het
Vsig4 A G X: 96,290,816 V29A probably benign Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wnk3 T A X: 151,286,304 F886I probably benign Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfp507 A T 7: 35,787,770 Y234N probably damaging Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6298147 missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6294300 missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6277338 missense probably damaging 1.00
declining UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6298300 missense
R2062:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2064:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2065:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2066:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2067:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2068:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2217:Ehd1 UTSW 19 6298472 missense probably damaging 1.00
R3705:Ehd1 UTSW 19 6298300 missense
R4654:Ehd1 UTSW 19 6276964 utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6294243 missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6297694 missense probably benign 0.14
R5076:Ehd1 UTSW 19 6277221 missense probably benign 0.02
R6327:Ehd1 UTSW 19 6298345 missense possibly damaging 0.81
R6679:Ehd1 UTSW 19 6294444 missense probably benign 0.01
R7120:Ehd1 UTSW 19 6297561 missense probably benign 0.00
R7183:Ehd1 UTSW 19 6297654 missense probably benign 0.02
R7215:Ehd1 UTSW 19 6297642 missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6277195 missense probably damaging 0.99
R8467:Ehd1 UTSW 19 6281288 missense probably benign 0.24
R8523:Ehd1 UTSW 19 6294583 missense probably damaging 0.98
R8879:Ehd1 UTSW 19 6298324 missense probably damaging 0.97
R8957:Ehd1 UTSW 19 6294409 missense probably damaging 1.00
R9011:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R9664:Ehd1 UTSW 19 6281232 missense probably benign 0.01
R9687:Ehd1 UTSW 19 6298300 missense
Predicted Primers PCR Primer
(F):5'- ATTATAAAGGGGCGGCTCG -3'
(R):5'- ATGACCGCGATGAAGGAGTC -3'

Sequencing Primer
(F):5'- GCTGTCGTGGTCCTCAC -3'
(R):5'- GGAAGTCCTGCTCGATCAG -3'
Posted On 2015-09-14