Incidental Mutation 'R3431:Dhrs7'
ID334587
Institutional Source Beutler Lab
Gene Symbol Dhrs7
Ensembl Gene ENSMUSG00000021094
Gene Namedehydrogenase/reductase (SDR family) member 7
SynonymsretSDR4, 2310016E22Rik, 5730564L20Rik, retDSR4
MMRRC Submission 040649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3431 (G1)
Quality Score44
Status Validated
Chromosome12
Chromosomal Location72650353-72664909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72664727 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 12 (L12Q)
Ref Sequence ENSEMBL: ENSMUSP00000152329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021512] [ENSMUST00000220821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021512
AA Change: L12Q

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021512
Gene: ENSMUSG00000021094
AA Change: L12Q

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:KR 51 227 2.5e-11 PFAM
Pfam:adh_short 51 250 4.4e-52 PFAM
Pfam:adh_short_C2 57 267 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220821
AA Change: L12Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221674
Predicted Effect unknown
Transcript: ENSMUST00000221750
AA Change: L9Q
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family, which has over 46,000 members. Members in this family are enzymes that metabolize many different compounds, such as steroid hormones, prostaglandins, retinoids, lipids and xenobiotics. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,589,216 H140R possibly damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Apob T G 12: 8,010,778 F3054V probably damaging Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Calcb A T 7: 114,719,829 R30W probably damaging Het
Cbl T C 9: 44,151,446 *914W probably null Het
Chd4 A G 6: 125,120,560 probably benign Het
Clec4a2 A T 6: 123,139,411 probably null Het
Crb2 T A 2: 37,792,217 V870E probably benign Het
Cyp2c39 A G 19: 39,536,862 E203G probably damaging Het
Dnah5 A G 15: 28,295,267 Y1382C probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Fsip2 A G 2: 82,992,010 E6029G possibly damaging Het
Gm20775 A T Y: 10,641,956 noncoding transcript Het
Gm4924 T A 10: 82,379,030 Y887* probably null Het
H60c G T 10: 3,260,382 R56S possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Knl1 A T 2: 119,062,362 E46D probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp21 T C 7: 133,678,750 T164A probably benign Het
Mthfd2 T C 6: 83,311,348 R142G probably benign Het
Mup4 T G 4: 59,959,192 probably null Het
Npas3 A T 12: 54,069,049 Q900L probably damaging Het
Nr1h3 T C 2: 91,191,860 D141G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rttn A G 18: 89,095,571 T1705A probably benign Het
Ryr3 A T 2: 112,656,531 V3834E probably damaging Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Tmem232 A T 17: 65,265,302 probably null Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Tulp4 C A 17: 6,206,964 S311R probably benign Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Usp34 T C 11: 23,370,466 I917T possibly damaging Het
Other mutations in Dhrs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dhrs7 APN 12 72659350 missense probably damaging 1.00
IGL00715:Dhrs7 APN 12 72652390 missense probably damaging 1.00
IGL02398:Dhrs7 APN 12 72664692 missense probably damaging 1.00
R0421:Dhrs7 UTSW 12 72653086 splice site probably benign
R0691:Dhrs7 UTSW 12 72652351 missense probably damaging 1.00
R1640:Dhrs7 UTSW 12 72652315 missense possibly damaging 0.86
R1696:Dhrs7 UTSW 12 72653120 missense possibly damaging 0.88
R1727:Dhrs7 UTSW 12 72659464 missense probably damaging 1.00
R1791:Dhrs7 UTSW 12 72653165 missense probably benign 0.13
R2046:Dhrs7 UTSW 12 72652266 missense possibly damaging 0.47
R2124:Dhrs7 UTSW 12 72653177 missense probably damaging 1.00
R2205:Dhrs7 UTSW 12 72656370 missense probably damaging 1.00
R2356:Dhrs7 UTSW 12 72652381 missense probably benign 0.00
R4492:Dhrs7 UTSW 12 72653125 missense probably damaging 1.00
R4744:Dhrs7 UTSW 12 72652251 missense possibly damaging 0.94
R4747:Dhrs7 UTSW 12 72653118 missense probably benign 0.03
R5050:Dhrs7 UTSW 12 72657410 missense probably damaging 1.00
R5076:Dhrs7 UTSW 12 72659481 missense probably benign 0.00
R5678:Dhrs7 UTSW 12 72657332 missense probably damaging 1.00
R6361:Dhrs7 UTSW 12 72664659 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGGCTCAGCTTGGCAAC -3'
(R):5'- CTTCTATTGCAACACCCCGG -3'

Sequencing Primer
(F):5'- AACAGCTGGGAGGGACCTC -3'
(R):5'- AGTCTTGCACGCAGTAGG -3'
Posted On2015-09-15