Incidental Mutation 'R0208:Col9a2'
ID33460
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Namecollagen, type IX, alpha 2
SynonymsCol9a-2
MMRRC Submission 038461-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0208 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location121039385-121055322 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 121052288 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
Predicted Effect probably benign
Transcript: ENSMUST00000030372
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,661 V29A probably benign Het
Adgrb1 T C 15: 74,586,807 F313L probably benign Het
Arfgef2 C T 2: 166,867,422 R1140W probably damaging Het
Arhgef15 A T 11: 68,946,373 N797K probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Asb2 T A 12: 103,325,271 N466Y possibly damaging Het
Atp8a1 A T 5: 67,774,721 probably null Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdk7 G T 13: 100,706,514 D202E probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Clstn3 A G 6: 124,432,169 probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Gcfc2 A T 6: 81,943,463 S410C probably null Het
Grik3 T A 4: 125,686,165 Y568N probably damaging Het
Gsr T A 8: 33,689,355 D330E possibly damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hepacam2 A T 6: 3,467,505 probably benign Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Idua T A 5: 108,681,752 F447I probably damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mtor C A 4: 148,464,975 H605Q probably benign Het
Muc19 A G 15: 91,893,024 noncoding transcript Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Nptxr A T 15: 79,789,715 C366S probably null Het
Olfr1099 G T 2: 86,959,404 T18K probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr498 A G 7: 108,465,543 D73G probably damaging Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pde3b A G 7: 114,497,981 T428A probably benign Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Polr1d A C 5: 147,078,680 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rasip1 C A 7: 45,632,575 P501T probably damaging Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Secisbp2 A G 13: 51,679,845 T674A probably benign Het
Serpinb6c G A 13: 33,897,396 S90L probably benign Het
Sgsm2 A G 11: 74,868,241 I170T probably damaging Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Unc79 G A 12: 103,092,027 V1016I probably benign Het
Usf3 C A 16: 44,216,906 A583E probably damaging Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Zmat4 T A 8: 23,902,067 M13K probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
collision UTSW 4 121049716 critical splice donor site probably null
gravity_wave UTSW 4 121044019 critical splice donor site probably null
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1023:Col9a2 UTSW 4 121044010 missense unknown
R1657:Col9a2 UTSW 4 121040974 missense unknown
R1724:Col9a2 UTSW 4 121053902 missense probably damaging 1.00
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2223:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2393:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
R7571:Col9a2 UTSW 4 121039784 missense unknown
Z1176:Col9a2 UTSW 4 121053797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTCTCTGACAAGCCCTCAAATG -3'
(R):5'- TTCTGGTCTAACCCAATCCCACGG -3'

Sequencing Primer
(F):5'- GCCCTCAAATGAATGTCTGTAAC -3'
(R):5'- CTACAGCAGCCCAGACTTG -3'
Posted On2013-05-09