Incidental Mutation 'R0208:Grik3'
ID 33461
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission 038461-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R0208 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 125384493-125607966 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125579958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 568 (Y568N)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably damaging
Transcript: ENSMUST00000030676
AA Change: Y568N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: Y568N

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Meta Mutation Damage Score 0.9369 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 C T 3: 59,840,110 (GRCm39) R61C probably damaging Het
Ackr4 A G 9: 103,976,860 (GRCm39) V29A probably benign Het
Adgrb1 T C 15: 74,458,656 (GRCm39) F313L probably benign Het
Arfgef2 C T 2: 166,709,342 (GRCm39) R1140W probably damaging Het
Arhgef15 A T 11: 68,837,199 (GRCm39) N797K probably benign Het
Arhgef5 A G 6: 43,250,275 (GRCm39) E342G probably damaging Het
Asb2 T A 12: 103,291,530 (GRCm39) N466Y possibly damaging Het
Atp8a1 A T 5: 67,932,064 (GRCm39) probably null Het
Cacna1b A G 2: 24,497,492 (GRCm39) S2140P probably damaging Het
Camsap2 G C 1: 136,208,738 (GRCm39) P918R probably damaging Het
Cdk7 G T 13: 100,843,022 (GRCm39) D202E probably benign Het
Cenpj G T 14: 56,801,427 (GRCm39) A182E probably benign Het
Clstn3 A G 6: 124,409,128 (GRCm39) probably benign Het
Col9a2 C T 4: 120,909,485 (GRCm39) probably benign Het
D630045J12Rik A G 6: 38,116,385 (GRCm39) M1745T probably damaging Het
Dnah11 A C 12: 118,007,509 (GRCm39) N2156K probably damaging Het
Dock3 G T 9: 106,874,195 (GRCm39) Y425* probably null Het
Eng A T 2: 32,569,005 (GRCm39) T511S probably benign Het
Gcfc2 A T 6: 81,920,444 (GRCm39) S410C probably null Het
Gsr T A 8: 34,179,383 (GRCm39) D330E possibly damaging Het
H2-M10.4 A G 17: 36,771,375 (GRCm39) W268R probably damaging Het
Hepacam2 A T 6: 3,467,505 (GRCm39) probably benign Het
Hrct1 C A 4: 43,727,384 (GRCm39) T8K possibly damaging Het
Idua T A 5: 108,829,618 (GRCm39) F447I probably damaging Het
Il2ra T C 2: 11,686,828 (GRCm39) probably benign Het
Ipcef1 A G 10: 6,870,062 (GRCm39) S113P probably damaging Het
Klk1b9 T A 7: 43,628,854 (GRCm39) N119K possibly damaging Het
Krtap9-3 C A 11: 99,488,663 (GRCm39) C73F probably damaging Het
Loxhd1 T A 18: 77,492,562 (GRCm39) F1334L possibly damaging Het
Med1 A G 11: 98,046,515 (GRCm39) probably benign Het
Med13 A G 11: 86,191,682 (GRCm39) probably benign Het
Mtor C A 4: 148,549,432 (GRCm39) H605Q probably benign Het
Muc19 A G 15: 91,777,218 (GRCm39) noncoding transcript Het
Mybphl T C 3: 108,282,731 (GRCm39) V207A probably damaging Het
Nptxr A T 15: 79,673,916 (GRCm39) C366S probably null Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or5p73 A G 7: 108,064,750 (GRCm39) D73G probably damaging Het
Or8h9 G T 2: 86,789,748 (GRCm39) T18K probably damaging Het
Pcdhb18 T C 18: 37,623,240 (GRCm39) I190T possibly damaging Het
Pde3b A G 7: 114,097,216 (GRCm39) T428A probably benign Het
Pgbd1 A C 13: 21,618,651 (GRCm39) L2R probably damaging Het
Pkp4 A G 2: 59,096,780 (GRCm39) I61V probably damaging Het
Pold4 T G 19: 4,282,593 (GRCm39) Y58* probably null Het
Polr1d A C 5: 147,015,490 (GRCm39) probably null Het
Prex2 T A 1: 11,355,368 (GRCm39) D1556E probably damaging Het
Psmd1 T C 1: 86,061,463 (GRCm39) V891A possibly damaging Het
Rasip1 C A 7: 45,281,999 (GRCm39) P501T probably damaging Het
Scgb2b27 C A 7: 33,711,562 (GRCm39) E96* probably null Het
Sec16b G T 1: 157,380,505 (GRCm39) G359* probably null Het
Secisbp2 A G 13: 51,833,881 (GRCm39) T674A probably benign Het
Serpinb6c G A 13: 34,081,379 (GRCm39) S90L probably benign Het
Sgsm2 A G 11: 74,759,067 (GRCm39) I170T probably damaging Het
Slc28a1 A T 7: 80,767,454 (GRCm39) probably benign Het
Slc35d1 T C 4: 103,065,351 (GRCm39) T177A probably damaging Het
Spg11 C T 2: 121,886,177 (GRCm39) probably null Het
Spint1 T C 2: 119,078,826 (GRCm39) probably benign Het
Spta1 A G 1: 174,020,526 (GRCm39) H545R probably damaging Het
Tada3 A T 6: 113,343,968 (GRCm39) L227Q probably damaging Het
Tln1 C T 4: 43,549,151 (GRCm39) V644M probably damaging Het
Unc79 G A 12: 103,058,286 (GRCm39) V1016I probably benign Het
Usf3 C A 16: 44,037,269 (GRCm39) A583E probably damaging Het
Ush2a A C 1: 188,263,958 (GRCm39) I1612L probably damaging Het
Vmn2r6 T C 3: 64,447,333 (GRCm39) T578A probably benign Het
Zmat4 T A 8: 24,392,083 (GRCm39) M13K probably damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125,526,208 (GRCm39) missense probably benign
IGL01534:Grik3 APN 4 125,579,983 (GRCm39) missense probably damaging 1.00
IGL01538:Grik3 APN 4 125,587,829 (GRCm39) missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125,517,295 (GRCm39) missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125,579,783 (GRCm39) splice site probably benign
IGL02475:Grik3 APN 4 125,544,310 (GRCm39) missense probably benign
IGL03198:Grik3 APN 4 125,553,555 (GRCm39) missense probably benign 0.25
IGL03307:Grik3 APN 4 125,535,347 (GRCm39) missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0116:Grik3 UTSW 4 125,564,349 (GRCm39) missense probably benign 0.01
R0497:Grik3 UTSW 4 125,517,303 (GRCm39) missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1296:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1515:Grik3 UTSW 4 125,564,521 (GRCm39) missense probably benign 0.37
R1559:Grik3 UTSW 4 125,601,790 (GRCm39) missense probably benign 0.16
R1617:Grik3 UTSW 4 125,584,985 (GRCm39) missense probably benign
R1848:Grik3 UTSW 4 125,587,931 (GRCm39) missense probably damaging 1.00
R2903:Grik3 UTSW 4 125,564,437 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3842:Grik3 UTSW 4 125,587,747 (GRCm39) splice site probably benign
R4649:Grik3 UTSW 4 125,544,278 (GRCm39) missense probably damaging 1.00
R4841:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R4842:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R5093:Grik3 UTSW 4 125,564,382 (GRCm39) missense probably benign
R5318:Grik3 UTSW 4 125,587,929 (GRCm39) missense probably damaging 0.96
R5549:Grik3 UTSW 4 125,579,838 (GRCm39) missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125,598,916 (GRCm39) missense probably damaging 0.99
R6226:Grik3 UTSW 4 125,553,582 (GRCm39) missense probably benign 0.04
R6306:Grik3 UTSW 4 125,526,205 (GRCm39) missense probably benign 0.01
R6672:Grik3 UTSW 4 125,517,309 (GRCm39) missense probably benign 0.08
R6682:Grik3 UTSW 4 125,544,259 (GRCm39) missense probably damaging 1.00
R6783:Grik3 UTSW 4 125,526,093 (GRCm39) missense probably benign 0.01
R7390:Grik3 UTSW 4 125,543,532 (GRCm39) missense probably damaging 1.00
R7604:Grik3 UTSW 4 125,517,428 (GRCm39) missense probably damaging 0.97
R7790:Grik3 UTSW 4 125,579,812 (GRCm39) missense probably damaging 1.00
R7822:Grik3 UTSW 4 125,550,190 (GRCm39) critical splice donor site probably null
R7952:Grik3 UTSW 4 125,598,340 (GRCm39) missense probably damaging 1.00
R8418:Grik3 UTSW 4 125,579,835 (GRCm39) missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125,550,166 (GRCm39) missense probably damaging 1.00
R9030:Grik3 UTSW 4 125,526,185 (GRCm39) missense probably benign 0.24
R9243:Grik3 UTSW 4 125,601,690 (GRCm39) missense probably benign 0.00
R9792:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
R9793:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
Z1177:Grik3 UTSW 4 125,544,299 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCATGAGTGGGTTCTCCAACACATC -3'
(R):5'- AGTGTCACTGGCATGGACCAGAAG -3'

Sequencing Primer
(F):5'- GTCTATGGTCTCTTTACAGAAAGCAG -3'
(R):5'- ACAAAGGATCTGTGCTGCG -3'
Posted On 2013-05-09