Incidental Mutation 'R0208:D630045J12Rik'
ID33467
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 038461-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0208 (G1)
Quality Score171
Status Validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38139450 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1745 (M1745T)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect probably damaging
Transcript: ENSMUST00000117556
AA Change: M1604T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: M1604T

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect probably damaging
Transcript: ENSMUST00000169256
AA Change: M1745T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: M1745T

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,661 V29A probably benign Het
Adgrb1 T C 15: 74,586,807 F313L probably benign Het
Arfgef2 C T 2: 166,867,422 R1140W probably damaging Het
Arhgef15 A T 11: 68,946,373 N797K probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Asb2 T A 12: 103,325,271 N466Y possibly damaging Het
Atp8a1 A T 5: 67,774,721 probably null Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdk7 G T 13: 100,706,514 D202E probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Clstn3 A G 6: 124,432,169 probably benign Het
Col9a2 C T 4: 121,052,288 probably benign Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Gcfc2 A T 6: 81,943,463 S410C probably null Het
Grik3 T A 4: 125,686,165 Y568N probably damaging Het
Gsr T A 8: 33,689,355 D330E possibly damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hepacam2 A T 6: 3,467,505 probably benign Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Idua T A 5: 108,681,752 F447I probably damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mtor C A 4: 148,464,975 H605Q probably benign Het
Muc19 A G 15: 91,893,024 noncoding transcript Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Nptxr A T 15: 79,789,715 C366S probably null Het
Olfr1099 G T 2: 86,959,404 T18K probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr498 A G 7: 108,465,543 D73G probably damaging Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pde3b A G 7: 114,497,981 T428A probably benign Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Polr1d A C 5: 147,078,680 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rasip1 C A 7: 45,632,575 P501T probably damaging Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Secisbp2 A G 13: 51,679,845 T674A probably benign Het
Serpinb6c G A 13: 33,897,396 S90L probably benign Het
Sgsm2 A G 11: 74,868,241 I170T probably damaging Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Unc79 G A 12: 103,092,027 V1016I probably benign Het
Usf3 C A 16: 44,216,906 A583E probably damaging Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Zmat4 T A 8: 23,902,067 M13K probably damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38136950 missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
R7376:D630045J12Rik UTSW 6 38174303 missense probably damaging 0.99
R7491:D630045J12Rik UTSW 6 38142666 missense possibly damaging 0.89
R7552:D630045J12Rik UTSW 6 38148448 missense probably damaging 0.99
R7560:D630045J12Rik UTSW 6 38196627 missense possibly damaging 0.72
R7593:D630045J12Rik UTSW 6 38195494 missense possibly damaging 0.93
R7624:D630045J12Rik UTSW 6 38149563 missense probably damaging 1.00
R7654:D630045J12Rik UTSW 6 38177701 missense probably damaging 1.00
R7950:D630045J12Rik UTSW 6 38181310 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACATCTTTACCACTGAGTCATCTCCCAA -3'
(R):5'- GCAGAACCCCAGTAGCATTCCAA -3'

Sequencing Primer
(F):5'- tctcCCAAATGACTCAATATTTTGCC -3'
(R):5'- ccttccttcctccctccc -3'
Posted On2013-05-09