Incidental Mutation 'R0208:Sgsm2'
ID33484
Institutional Source Beutler Lab
Gene Symbol Sgsm2
Ensembl Gene ENSMUSG00000038351
Gene Namesmall G protein signaling modulator 2
SynonymsD630003G22Rik, Rutbc1
MMRRC Submission 038461-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R0208 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74849261-74897060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74868241 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 170 (I170T)
Ref Sequence ENSEMBL: ENSMUSP00000080489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]
Predicted Effect probably damaging
Transcript: ENSMUST00000057631
AA Change: I170T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: I170T

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081799
AA Change: I170T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: I170T

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184562
Meta Mutation Damage Score 0.5776 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,661 V29A probably benign Het
Adgrb1 T C 15: 74,586,807 F313L probably benign Het
Arfgef2 C T 2: 166,867,422 R1140W probably damaging Het
Arhgef15 A T 11: 68,946,373 N797K probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Asb2 T A 12: 103,325,271 N466Y possibly damaging Het
Atp8a1 A T 5: 67,774,721 probably null Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdk7 G T 13: 100,706,514 D202E probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Clstn3 A G 6: 124,432,169 probably benign Het
Col9a2 C T 4: 121,052,288 probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Gcfc2 A T 6: 81,943,463 S410C probably null Het
Grik3 T A 4: 125,686,165 Y568N probably damaging Het
Gsr T A 8: 33,689,355 D330E possibly damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hepacam2 A T 6: 3,467,505 probably benign Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Idua T A 5: 108,681,752 F447I probably damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mtor C A 4: 148,464,975 H605Q probably benign Het
Muc19 A G 15: 91,893,024 noncoding transcript Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Nptxr A T 15: 79,789,715 C366S probably null Het
Olfr1099 G T 2: 86,959,404 T18K probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr498 A G 7: 108,465,543 D73G probably damaging Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pde3b A G 7: 114,497,981 T428A probably benign Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Polr1d A C 5: 147,078,680 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rasip1 C A 7: 45,632,575 P501T probably damaging Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Secisbp2 A G 13: 51,679,845 T674A probably benign Het
Serpinb6c G A 13: 33,897,396 S90L probably benign Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Unc79 G A 12: 103,092,027 V1016I probably benign Het
Usf3 C A 16: 44,216,906 A583E probably damaging Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Zmat4 T A 8: 23,902,067 M13K probably damaging Het
Other mutations in Sgsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Sgsm2 APN 11 74853871 missense possibly damaging 0.91
IGL02164:Sgsm2 APN 11 74865416 missense possibly damaging 0.90
IGL02236:Sgsm2 APN 11 74859872 missense probably damaging 1.00
IGL02330:Sgsm2 APN 11 74858667 missense probably benign 0.01
IGL02352:Sgsm2 APN 11 74892074 splice site probably benign
IGL02359:Sgsm2 APN 11 74892074 splice site probably benign
IGL03061:Sgsm2 APN 11 74851136 missense probably damaging 1.00
IGL03180:Sgsm2 APN 11 74868575 critical splice donor site probably null
R0433:Sgsm2 UTSW 11 74858190 splice site probably null
R0517:Sgsm2 UTSW 11 74867651 missense possibly damaging 0.62
R0755:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R1439:Sgsm2 UTSW 11 74869138 missense probably benign 0.34
R1527:Sgsm2 UTSW 11 74853848 nonsense probably null
R1713:Sgsm2 UTSW 11 74896826 missense probably null 0.04
R1962:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R2189:Sgsm2 UTSW 11 74853082 missense probably damaging 1.00
R4259:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4261:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4408:Sgsm2 UTSW 11 74851766 missense probably damaging 0.99
R4590:Sgsm2 UTSW 11 74851132 missense probably damaging 1.00
R6137:Sgsm2 UTSW 11 74850851 missense probably damaging 1.00
R6162:Sgsm2 UTSW 11 74892021 missense probably damaging 1.00
R6457:Sgsm2 UTSW 11 74865169 missense possibly damaging 0.77
R6681:Sgsm2 UTSW 11 74865378 missense probably damaging 0.99
R6722:Sgsm2 UTSW 11 74865424 missense probably damaging 1.00
R6986:Sgsm2 UTSW 11 74892041 missense probably damaging 1.00
R7205:Sgsm2 UTSW 11 74854493 missense possibly damaging 0.88
R7209:Sgsm2 UTSW 11 74854325 missense probably damaging 0.98
R7655:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R7656:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R8526:Sgsm2 UTSW 11 74869021 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCTGTCTTGAGCTTCGTGTATTCC -3'
(R):5'- ACAGTACCTGGCCGAAAACTGC -3'

Sequencing Primer
(F):5'- TCGTGTATTCCAAGGCACAG -3'
(R):5'- TCCTTTGGCACCCCAAGAATATAG -3'
Posted On2013-05-09