Mutagenetix > Incidental Mutation

Incidental Mutation 'R0208:Med13'

33485

Institutional Source

Beutler Lab

Gene Symbol

Med13

Ensembl Gene

ENSMUSG00000034297

Gene Name

mediator complex subunit 13

Synonyms

Thrap1, 1110067M05Rik, Trap240

MMRRC Submission

038461-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R0208 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86267033-86357602 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 86300856 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043624]

AlphaFold

Q5SWW4

Predicted Effect

probably benign
Transcript: ENSMUST00000043624

SMART Domains

Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	384	5e-130	PFAM
low complexity region	438	451	N/A	INTRINSIC
low complexity region	531	540	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	984	998	N/A	INTRINSIC
low complexity region	1001	1029	N/A	INTRINSIC
low complexity region	1463	1476	N/A	INTRINSIC
low complexity region	1502	1517	N/A	INTRINSIC
low complexity region	1522	1550	N/A	INTRINSIC
low complexity region	1559	1570	N/A	INTRINSIC
low complexity region	1577	1596	N/A	INTRINSIC
Pfam:Med13_C	1637	2161	3.5e-146	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.7%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr4	A	G	9: 104,099,661	V29A	probably benign	Het
Adgrb1	T	C	15: 74,586,807	F313L	probably benign	Het
Arfgef2	C	T	2: 166,867,422	R1140W	probably damaging	Het
Arhgef15	A	T	11: 68,946,373	N797K	probably benign	Het
Arhgef5	A	G	6: 43,273,341	E342G	probably damaging	Het
Asb2	T	A	12: 103,325,271	N466Y	possibly damaging	Het
Atp8a1	A	T	5: 67,774,721		probably null	Het
C130079G13Rik	C	T	3: 59,932,689	R61C	probably damaging	Het
Cacna1b	A	G	2: 24,607,480	S2140P	probably damaging	Het
Camsap2	G	C	1: 136,281,000	P918R	probably damaging	Het
Cdk7	G	T	13: 100,706,514	D202E	probably benign	Het
Cenpj	G	T	14: 56,563,970	A182E	probably benign	Het
Clstn3	A	G	6: 124,432,169		probably benign	Het
Col9a2	C	T	4: 121,052,288		probably benign	Het
D630045J12Rik	A	G	6: 38,139,450	M1745T	probably damaging	Het
Dnah11	A	C	12: 118,043,774	N2156K	probably damaging	Het
Dock3	G	T	9: 106,996,996	Y425*	probably null	Het
Eng	A	T	2: 32,678,993	T511S	probably benign	Het
Gcfc2	A	T	6: 81,943,463	S410C	probably null	Het
Grik3	T	A	4: 125,686,165	Y568N	probably damaging	Het
Gsr	T	A	8: 33,689,355	D330E	possibly damaging	Het
H2-M10.4	A	G	17: 36,460,483	W268R	probably damaging	Het
Hepacam2	A	T	6: 3,467,505		probably benign	Het
Hrct1	C	A	4: 43,727,384	T8K	possibly damaging	Het
Idua	T	A	5: 108,681,752	F447I	probably damaging	Het
Il2ra	T	C	2: 11,682,017		probably benign	Het
Ipcef1	A	G	10: 6,920,062	S113P	probably damaging	Het
Klk1b9	T	A	7: 43,979,430	N119K	possibly damaging	Het
Krtap9-3	C	A	11: 99,597,837	C73F	probably damaging	Het
Loxhd1	T	A	18: 77,404,866	F1334L	possibly damaging	Het
Med1	A	G	11: 98,155,689		probably benign	Het
Mtor	C	A	4: 148,464,975	H605Q	probably benign	Het
Muc19	A	G	15: 91,893,024		noncoding transcript	Het
Mybphl	T	C	3: 108,375,415	V207A	probably damaging	Het
Nptxr	A	T	15: 79,789,715	C366S	probably null	Het
Olfr1099	G	T	2: 86,959,404	T18K	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr498	A	G	7: 108,465,543	D73G	probably damaging	Het
Pcdhb18	T	C	18: 37,490,187	I190T	possibly damaging	Het
Pde3b	A	G	7: 114,497,981	T428A	probably benign	Het
Pgbd1	A	C	13: 21,434,481	L2R	probably damaging	Het
Pkp4	A	G	2: 59,266,436	I61V	probably damaging	Het
Pold4	T	G	19: 4,232,539	Y58*	probably null	Het
Polr1d	A	C	5: 147,078,680		probably null	Het
Prex2	T	A	1: 11,285,144	D1556E	probably damaging	Het
Psmd1	T	C	1: 86,133,741	V891A	possibly damaging	Het
Rasip1	C	A	7: 45,632,575	P501T	probably damaging	Het
Scgb2b27	C	A	7: 34,012,137	E96*	probably null	Het
Sec16b	G	T	1: 157,552,935	G359*	probably null	Het
Secisbp2	A	G	13: 51,679,845	T674A	probably benign	Het
Serpinb6c	G	A	13: 33,897,396	S90L	probably benign	Het
Sgsm2	A	G	11: 74,868,241	I170T	probably damaging	Het
Slc28a1	A	T	7: 81,117,706		probably benign	Het
Slc35d1	T	C	4: 103,208,154	T177A	probably damaging	Het
Spg11	C	T	2: 122,055,696		probably null	Het
Spint1	T	C	2: 119,248,345		probably benign	Het
Spta1	A	G	1: 174,192,960	H545R	probably damaging	Het
Tada3	A	T	6: 113,367,007	L227Q	probably damaging	Het
Tln1	C	T	4: 43,549,151	V644M	probably damaging	Het
Unc79	G	A	12: 103,092,027	V1016I	probably benign	Het
Usf3	C	A	16: 44,216,906	A583E	probably damaging	Het
Ush2a	A	C	1: 188,531,761	I1612L	probably damaging	Het
Vmn2r6	T	C	3: 64,539,912	T578A	probably benign	Het
Zmat4	T	A	8: 23,902,067	M13K	probably damaging	Het

Other mutations in Med13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Med13	APN	11	86291040	splice site	probably benign
IGL01391:Med13	APN	11	86328497	missense	probably benign
IGL01767:Med13	APN	11	86319783	missense	probably benign	0.38
IGL01830:Med13	APN	11	86288928	splice site	probably benign
IGL01859:Med13	APN	11	86283751	missense	possibly damaging	0.86
IGL01924:Med13	APN	11	86308696	splice site	probably benign
IGL02080:Med13	APN	11	86283812	missense	probably damaging	0.97
IGL02138:Med13	APN	11	86286765	missense	probably damaging	0.99
IGL02259:Med13	APN	11	86357501	missense	possibly damaging	0.89
IGL02339:Med13	APN	11	86288939	missense	probably benign	0.16
IGL02399:Med13	APN	11	86283945	splice site	probably benign
IGL02646:Med13	APN	11	86283386	missense	probably benign	0.00
IGL03227:Med13	APN	11	86327792	splice site	probably benign
R0197_Med13_854	UTSW	11	86307038	missense	probably benign	0.13
R0360_Med13_060	UTSW	11	86329161	splice site	probably benign
R2359_Med13_079	UTSW	11	86291035	splice site	probably benign
R3735_Med13_085	UTSW	11	86279658	missense	probably benign	0.00
R4974_Med13_508	UTSW	11	86298847	missense	probably damaging	0.98
R0116:Med13	UTSW	11	86319897	missense	probably damaging	0.99
R0189:Med13	UTSW	11	86319876	missense	probably benign
R0197:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0206:Med13	UTSW	11	86300856	splice site	probably benign
R0310:Med13	UTSW	11	86346003	missense	probably benign	0.11
R0360:Med13	UTSW	11	86329161	splice site	probably benign
R0413:Med13	UTSW	11	86299207	splice site	probably benign
R0482:Med13	UTSW	11	86285151	missense	probably benign	0.41
R0497:Med13	UTSW	11	86276983	splice site	probably benign
R0589:Med13	UTSW	11	86283249	missense	probably damaging	1.00
R0601:Med13	UTSW	11	86345962	missense	possibly damaging	0.47
R0646:Med13	UTSW	11	86331089	missense	possibly damaging	0.95
R0701:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0709:Med13	UTSW	11	86319596	missense	possibly damaging	0.95
R0711:Med13	UTSW	11	86301353	splice site	probably benign
R0734:Med13	UTSW	11	86301237	missense	probably benign
R0883:Med13	UTSW	11	86307038	missense	probably benign	0.13
R1793:Med13	UTSW	11	86329351	missense	probably benign	0.45
R1926:Med13	UTSW	11	86289073	missense	possibly damaging	0.47
R1959:Med13	UTSW	11	86298979	missense	probably damaging	1.00
R2286:Med13	UTSW	11	86319689	missense	probably benign	0.05
R2359:Med13	UTSW	11	86291035	splice site	probably benign
R2444:Med13	UTSW	11	86331960	missense	probably damaging	1.00
R2679:Med13	UTSW	11	86298577	missense	probably benign	0.00
R2879:Med13	UTSW	11	86299162	missense	possibly damaging	0.61
R3439:Med13	UTSW	11	86285297	missense	probably damaging	1.00
R3735:Med13	UTSW	11	86279658	missense	probably benign	0.00
R4333:Med13	UTSW	11	86288183	missense	probably benign
R4558:Med13	UTSW	11	86299054	missense	probably damaging	1.00
R4598:Med13	UTSW	11	86278566	missense	probably damaging	0.97
R4773:Med13	UTSW	11	86276920	missense	probably damaging	0.99
R4801:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4802:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4806:Med13	UTSW	11	86298577	missense	probably benign	0.00
R4940:Med13	UTSW	11	86288118	missense	probably damaging	1.00
R4974:Med13	UTSW	11	86298847	missense	probably damaging	0.98
R5056:Med13	UTSW	11	86328565	missense	probably benign	0.00
R5133:Med13	UTSW	11	86319849	missense	probably benign	0.32
R5206:Med13	UTSW	11	86319879	missense	probably damaging	1.00
R5352:Med13	UTSW	11	86301468	missense	possibly damaging	0.82
R5534:Med13	UTSW	11	86319365	missense	probably benign	0.09
R5556:Med13	UTSW	11	86327838	missense	probably benign	0.25
R5633:Med13	UTSW	11	86278931	splice site	probably benign
R5769:Med13	UTSW	11	86346003	missense	probably benign	0.11
R6236:Med13	UTSW	11	86328531	missense	probably damaging	0.99
R6479:Med13	UTSW	11	86357527	start gained	probably benign
R6487:Med13	UTSW	11	86331150	missense	probably damaging	1.00
R6524:Med13	UTSW	11	86301467	missense	probably damaging	0.98
R6528:Med13	UTSW	11	86298954	missense	probably damaging	1.00
R6805:Med13	UTSW	11	86278796	missense	possibly damaging	0.48
R6913:Med13	UTSW	11	86319876	missense	probably benign
R7221:Med13	UTSW	11	86288095	missense	probably benign	0.00
R7254:Med13	UTSW	11	86319835	missense	probably benign
R7267:Med13	UTSW	11	86308826	missense	probably benign	0.01
R7309:Med13	UTSW	11	86291062	missense	probably benign	0.00
R7404:Med13	UTSW	11	86286446	missense	possibly damaging	0.53
R7586:Med13	UTSW	11	86271002	missense	probably damaging	0.99
R7704:Med13	UTSW	11	86345918	nonsense	probably null
R7922:Med13	UTSW	11	86271005	missense	probably damaging	0.98
R7943:Med13	UTSW	11	86278526	missense	probably damaging	0.97
R8062:Med13	UTSW	11	86319438	missense	probably benign
R8075:Med13	UTSW	11	86272470	missense	probably damaging	0.98
R8207:Med13	UTSW	11	86303549	missense	probably damaging	1.00
R8671:Med13	UTSW	11	86271097	missense	probably damaging	1.00
R9056:Med13	UTSW	11	86298834	nonsense	probably null
R9084:Med13	UTSW	11	86300795	missense	probably damaging	1.00
R9148:Med13	UTSW	11	86301471	missense	probably benign	0.27
R9329:Med13	UTSW	11	86298457	missense	probably benign	0.10
R9380:Med13	UTSW	11	86286772	missense	probably benign	0.42
R9515:Med13	UTSW	11	86308901	missense	probably benign	0.00
R9516:Med13	UTSW	11	86288975	missense	probably benign	0.01
R9690:Med13	UTSW	11	86278844	missense	probably damaging	1.00
R9751:Med13	UTSW	11	86299158	missense	probably damaging	1.00
R9752:Med13	UTSW	11	86283321	missense	possibly damaging	0.87
R9764:Med13	UTSW	11	86286519	missense	possibly damaging	0.89
Z1176:Med13	UTSW	11	86328544	missense	possibly damaging	0.91
Z1176:Med13	UTSW	11	86345862	missense	probably benign	0.45
Z1176:Med13	UTSW	11	86355423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTTGATGAATGGCATTGAAGGGC -3'
(R):5'- TCACTGGAACAGCACATTATGGGC -3'

Sequencing Primer
(F):5'- GCCTGAAGGAAGCAAGTCC -3'
(R):5'- GAACAGCACATTATGGGCTTCTC -3'

Posted On

2013-05-09