Incidental Mutation 'R0212:Pikfyve'

• ID: 33505
• Institutional Source: Beutler Lab
• Gene Symbol: Pikfyve
• Ensembl Gene: ENSMUSG00000025949
• Gene Name: phosphoinositide kinase, FYVE type zinc finger containing
• Synonyms: Pip5k3
• MMRRC Submission: 038463-MU
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R0212 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 1
• Chromosomal Location: 65186683-65278695 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to A at 65262905 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Tyrosine to Asparagine at position 1607 (Y1607N)
• Ref Sequence: ENSEMBL: ENSMUSP00000079926
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
• AlphaFold: Q9Z1T6
• Predicted Effect: probably benign; Transcript: ENSMUST00000081154; AA Change: Y1607N; PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
• SMART Domains: Protein: ENSMUSP00000079926; Gene: ENSMUSG00000025949; AA Change: Y1607N

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

• Predicted Effect: probably benign; Transcript: ENSMUST00000097707; AA Change: Y1652N; PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
• SMART Domains: Protein: ENSMUSP00000095314; Gene: ENSMUSG00000025949; AA Change: Y1652N

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

• Coding Region Coverage:
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010] ; PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
• Allele List at MGI:

  All alleles(16) : Gene trapped(16)

• Posted On: 2013-05-09

Predicted Primers

PCR Primer
(F):5'- GGGAGGCATTCTCTGAGGGTTAGAAA -3'
(R):5'- GCCATGCATCATCCCATTGTTAAAGC -3'

Sequencing Primer
(F):5'- ataaaagtgacagacagtgacaag -3'
(R):5'- AGACTCTCATGCTTAACAAACATAC -3'