Mutagenetix > Incidental Mutations

Incidental Mutation 'R0212:Chd6'

33519

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

038463-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.837) question?

Stock #

R0212 (G1)

Quality Score

172

Status

Not validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 161052847 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 31 (D31V)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000130265] [ENSMUST00000134178]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: D31V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: D31V

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125179

Predicted Effect

probably benign
Transcript: ENSMUST00000130265

SMART Domains

Protein: ENSMUSP00000117075
Gene: ENSMUSG00000057133

Domain	Start	End	E-Value	Type
low complexity region	1	23	N/A	INTRINSIC
Blast:CHROMO	26	210	4e-80	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000134178
AA Change: D31V

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: D31V

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138078

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	G	A	5: 35,848,910		probably null	Het
Adat1	T	A	8: 111,987,208	D113V	possibly damaging	Het
Arhgap40	T	G	2: 158,550,575	L656V	probably damaging	Het
Atg2a	T	C	19: 6,246,554	I330T	probably damaging	Het
Cad	A	G	5: 31,078,110	D2137G	probably damaging	Het
Cd8a	G	A	6: 71,373,649	E33K	probably benign	Het
Cemip	C	A	7: 83,973,190	G594C	probably damaging	Het
Cmpk1	A	T	4: 114,965,019	M111K	possibly damaging	Het
Crispld2	T	G	8: 120,010,631	H40Q	probably benign	Het
Depdc5	A	G	5: 32,912,242	T441A	probably benign	Het
Dpm1	T	C	2: 168,227,494	N5S	probably benign	Het
Ercc4	A	G	16: 13,123,332		probably null	Het
Fam83f	A	T	15: 80,690,578	M229L	probably benign	Het
Fgd5	A	T	6: 91,988,208	D474V	probably damaging	Het
Fgf21	G	T	7: 45,614,102	P184Q	probably benign	Het
Fry	A	T	5: 150,496,397	D1008V	probably damaging	Het
Gjd2	T	C	2: 114,011,472	T175A	probably benign	Het
Gphn	C	T	12: 78,637,552	T577I	probably damaging	Het
Ifi207	A	T	1: 173,736,398	N18K	possibly damaging	Het
Ifne	T	C	4: 88,879,735	R149G	possibly damaging	Het
Ift80	A	T	3: 68,940,173	L330H	probably benign	Het
Inpp4b	A	T	8: 81,770,917	H122L	probably benign	Het
Inpp5e	T	C	2: 26,408,340		probably null	Het
Ism1	T	C	2: 139,740,257	L163S	probably benign	Het
Itga11	T	A	9: 62,745,969	V375E	probably benign	Het
Itpr3	T	G	17: 27,089,319	F306V	probably damaging	Het
Kif19a	A	T	11: 114,784,910	I403F	possibly damaging	Het
Klf12	A	T	14: 100,022,862	S144T	probably benign	Het
Lyst	C	T	13: 13,635,985	H747Y	possibly damaging	Het
Mccc2	A	G	13: 99,954,655	Y445H	probably benign	Het
Mei1	G	A	15: 82,095,931		probably null	Het
Metap2	T	A	10: 93,861,380	K479N	probably damaging	Het
Mief2	A	T	11: 60,730,667	D62V	probably damaging	Het
Mtrf1	A	G	14: 79,419,279	D407G	probably benign	Het
Myo3a	A	G	2: 22,291,848	R210G	probably damaging	Het
Nkx2-2	T	C	2: 147,184,170	H216R	probably damaging	Het
Nos1	A	G	5: 117,910,212	E694G	possibly damaging	Het
Nptn	A	T	9: 58,627,881	Y103F	probably benign	Het
Nrxn1	A	G	17: 90,362,758		probably benign	Het
Numbl	T	C	7: 27,280,759	S389P	probably damaging	Het
Olfr1155	A	G	2: 87,943,091	F179S	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr152	C	T	2: 87,783,482	P314L	unknown	Het
Olfr357	A	T	2: 36,997,323	D171V	probably damaging	Het
Olfr357	T	A	2: 36,997,632	V274E	possibly damaging	Het
Olfr44	C	A	9: 39,485,088	S55I	probably damaging	Het
Olfr975	A	G	9: 39,949,940	V277A	probably benign	Het
Osm	T	G	11: 4,238,465	S31A	probably benign	Het
Paqr4	T	C	17: 23,738,320	M70V	probably benign	Het
Pikfyve	T	A	1: 65,262,905	Y1607N	probably benign	Het
Plec	A	C	15: 76,191,305	Y402*	probably null	Het
Polq	A	G	16: 37,066,854	K1631E	probably damaging	Het
Pou6f1	A	G	15: 100,580,815	V129A	possibly damaging	Het
Prm2	A	G	16: 10,791,599		probably benign	Het
Prtn3	A	G	10: 79,881,137	Y112C	probably damaging	Het
Qrfp	T	A	2: 31,808,785	H45L	probably benign	Het
Rps6ka5	A	T	12: 100,553,169		probably null	Het
Rspo1	G	A	4: 124,991,397	R22Q	probably benign	Het
Slc10a1	A	C	12: 80,967,712	L78R	possibly damaging	Het
Slc26a5	A	T	5: 21,823,549	Y340*	probably null	Het
Sptbn2	T	C	19: 4,746,942		probably null	Het
St3gal6	C	A	16: 58,473,453	A238S	probably damaging	Het
St3gal6	G	T	16: 58,473,455	A237E	probably damaging	Het
Tmem131l	A	T	3: 83,913,268	S1226T	probably benign	Het
Togaram2	C	T	17: 71,724,983	L866F	probably damaging	Het
Txndc17	A	G	11: 72,207,732	T37A	probably benign	Het
Vmn2r105	C	A	17: 20,208,565	V750F	possibly damaging	Het
Vmn2r54	T	A	7: 12,632,497	Y170F	probably benign	Het
Wrnip1	T	C	13: 32,821,906	V577A	probably benign	Het
Zc3h7b	A	G	15: 81,776,328	T226A	probably benign	Het
Zfp948	T	C	17: 21,588,160	I538T	probably benign	Het
Zzef1	A	G	11: 72,873,910	E1401G	possibly damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	not run
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTAATGGCAAAGGCAAACAGCCC -3'
(R):5'- ACATATTATCAGCACCATGATCCTGCG -3'

Sequencing Primer
(F):5'- GATCCATAATCAGTGCAGCTTC -3'
(R):5'- tgtgtcctgcttgctactg -3'

Posted On

2013-05-09