Mutagenetix > Incidental Mutation

Incidental Mutation 'R0212:Cad'

33528

Institutional Source

Beutler Lab

Gene Symbol

Cad

Ensembl Gene

ENSMUSG00000013629

Gene Name

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Synonyms

MMRRC Submission

038463-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R0212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31054780-31078479 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31078110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2137 (D2137G)

Ref Sequence

ENSEMBL: ENSMUSP00000144009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202795] [ENSMUST00000202973]

AlphaFold

B2RQC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000013773
AA Change: D2198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: D2198G

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.7e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.2e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.8e-85	PFAM
Pfam:ATP-grasp	522	690	1.5e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.2e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.8e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.4e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1924	2065	1.9e-44	PFAM
Pfam:OTCace	2071	2221	7.6e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200917

Predicted Effect

probably damaging
Transcript: ENSMUST00000200953
AA Change: D2135G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: D2135G

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:CPSase_L_D2	514	616	1.5e-34	PFAM
Pfam:Dala_Dala_lig_C	527	625	2.4e-7	PFAM
Pfam:CPSase_L_D2	614	655	4.9e-15	PFAM
CPSase_L_D3	735	858	9.7e-59	SMART
Pfam:ATP-grasp_4	981	1160	1.7e-23	PFAM
Pfam:CPSase_L_D2	984	1187	3e-28	PFAM
Pfam:Dala_Dala_lig_C	991	1179	2.3e-7	PFAM
Pfam:ATP-grasp	992	1159	2.1e-12	PFAM
MGS	1264	1365	1.35e-7	SMART
Pfam:Amidohydro_1	1399	1667	7.1e-12	PFAM
low complexity region	1757	1776	N/A	INTRINSIC
low complexity region	1801	1817	N/A	INTRINSIC
Pfam:OTCace_N	1861	2002	1.8e-44	PFAM
Pfam:OTCace	2008	2158	7.3e-37	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000201182
AA Change: D2127G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: D2127G

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.1e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.7e-85	PFAM
Pfam:ATP-grasp	522	690	1.4e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.1e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.7e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.1e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1949	1994	1.4e-11	PFAM
Pfam:OTCace	2000	2150	7.3e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000202795
AA Change: D2137G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: D2137G

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	1.9e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	5.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	1.2e-85	PFAM
Pfam:ATP-grasp	522	690	7.3e-10	PFAM
Pfam:Dala_Dala_lig_C	527	687	1.3e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	8.9e-24	PFAM
Pfam:CPSase_L_D2	1047	1250	2.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	1.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	1.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	2.5e-11	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1970	2004	4.6e-11	PFAM
Pfam:OTCace	2010	2160	9.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202827

Predicted Effect

probably benign
Transcript: ENSMUST00000202973

SMART Domains

Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
SCOP:d1gkra1	1	84	4e-28	SMART
PDB:4C6N\|A	1	119	4e-58	PDB
low complexity region	156	170	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	G	A	5: 35,848,910		probably null	Het
Adat1	T	A	8: 111,987,208	D113V	possibly damaging	Het
Arhgap40	T	G	2: 158,550,575	L656V	probably damaging	Het
Atg2a	T	C	19: 6,246,554	I330T	probably damaging	Het
Cd8a	G	A	6: 71,373,649	E33K	probably benign	Het
Cemip	C	A	7: 83,973,190	G594C	probably damaging	Het
Chd6	T	A	2: 161,052,847	D31V	probably damaging	Het
Cmpk1	A	T	4: 114,965,019	M111K	possibly damaging	Het
Crispld2	T	G	8: 120,010,631	H40Q	probably benign	Het
Depdc5	A	G	5: 32,912,242	T441A	probably benign	Het
Dpm1	T	C	2: 168,227,494	N5S	probably benign	Het
Ercc4	A	G	16: 13,123,332		probably null	Het
Fam83f	A	T	15: 80,690,578	M229L	probably benign	Het
Fgd5	A	T	6: 91,988,208	D474V	probably damaging	Het
Fgf21	G	T	7: 45,614,102	P184Q	probably benign	Het
Fry	A	T	5: 150,496,397	D1008V	probably damaging	Het
Gjd2	T	C	2: 114,011,472	T175A	probably benign	Het
Gphn	C	T	12: 78,637,552	T577I	probably damaging	Het
Ifi207	A	T	1: 173,736,398	N18K	possibly damaging	Het
Ifne	T	C	4: 88,879,735	R149G	possibly damaging	Het
Ift80	A	T	3: 68,940,173	L330H	probably benign	Het
Inpp4b	A	T	8: 81,770,917	H122L	probably benign	Het
Inpp5e	T	C	2: 26,408,340		probably null	Het
Ism1	T	C	2: 139,740,257	L163S	probably benign	Het
Itga11	T	A	9: 62,745,969	V375E	probably benign	Het
Itpr3	T	G	17: 27,089,319	F306V	probably damaging	Het
Kif19a	A	T	11: 114,784,910	I403F	possibly damaging	Het
Klf12	A	T	14: 100,022,862	S144T	probably benign	Het
Lyst	C	T	13: 13,635,985	H747Y	possibly damaging	Het
Mccc2	A	G	13: 99,954,655	Y445H	probably benign	Het
Mei1	G	A	15: 82,095,931		probably null	Het
Metap2	T	A	10: 93,861,380	K479N	probably damaging	Het
Mief2	A	T	11: 60,730,667	D62V	probably damaging	Het
Mtrf1	A	G	14: 79,419,279	D407G	probably benign	Het
Myo3a	A	G	2: 22,291,848	R210G	probably damaging	Het
Nkx2-2	T	C	2: 147,184,170	H216R	probably damaging	Het
Nos1	A	G	5: 117,910,212	E694G	possibly damaging	Het
Nptn	A	T	9: 58,627,881	Y103F	probably benign	Het
Nrxn1	A	G	17: 90,362,758		probably benign	Het
Numbl	T	C	7: 27,280,759	S389P	probably damaging	Het
Olfr1155	A	G	2: 87,943,091	F179S	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr152	C	T	2: 87,783,482	P314L	unknown	Het
Olfr357	A	T	2: 36,997,323	D171V	probably damaging	Het
Olfr357	T	A	2: 36,997,632	V274E	possibly damaging	Het
Olfr44	C	A	9: 39,485,088	S55I	probably damaging	Het
Olfr975	A	G	9: 39,949,940	V277A	probably benign	Het
Osm	T	G	11: 4,238,465	S31A	probably benign	Het
Paqr4	T	C	17: 23,738,320	M70V	probably benign	Het
Pikfyve	T	A	1: 65,262,905	Y1607N	probably benign	Het
Plec	A	C	15: 76,191,305	Y402*	probably null	Het
Polq	A	G	16: 37,066,854	K1631E	probably damaging	Het
Pou6f1	A	G	15: 100,580,815	V129A	possibly damaging	Het
Prm2	A	G	16: 10,791,599		probably benign	Het
Prtn3	A	G	10: 79,881,137	Y112C	probably damaging	Het
Qrfp	T	A	2: 31,808,785	H45L	probably benign	Het
Rps6ka5	A	T	12: 100,553,169		probably null	Het
Rspo1	G	A	4: 124,991,397	R22Q	probably benign	Het
Slc10a1	A	C	12: 80,967,712	L78R	possibly damaging	Het
Slc26a5	A	T	5: 21,823,549	Y340*	probably null	Het
Sptbn2	T	C	19: 4,746,942		probably null	Het
St3gal6	C	A	16: 58,473,453	A238S	probably damaging	Het
St3gal6	G	T	16: 58,473,455	A237E	probably damaging	Het
Tmem131l	A	T	3: 83,913,268	S1226T	probably benign	Het
Togaram2	C	T	17: 71,724,983	L866F	probably damaging	Het
Txndc17	A	G	11: 72,207,732	T37A	probably benign	Het
Vmn2r105	C	A	17: 20,208,565	V750F	possibly damaging	Het
Vmn2r54	T	A	7: 12,632,497	Y170F	probably benign	Het
Wrnip1	T	C	13: 32,821,906	V577A	probably benign	Het
Zc3h7b	A	G	15: 81,776,328	T226A	probably benign	Het
Zfp948	T	C	17: 21,588,160	I538T	probably benign	Het
Zzef1	A	G	11: 72,873,910	E1401G	possibly damaging	Het

Other mutations in Cad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Cad	APN	5	31061484	missense	probably damaging	1.00
IGL00908:Cad	APN	5	31059054	missense	possibly damaging	0.93
IGL01068:Cad	APN	5	31061770	splice site	probably benign
IGL01638:Cad	APN	5	31067614	missense	probably damaging	1.00
IGL02483:Cad	APN	5	31060826	critical splice acceptor site	probably null
IGL02499:Cad	APN	5	31069604	missense	probably damaging	1.00
IGL02691:Cad	APN	5	31055294	missense	probably damaging	1.00
IGL03002:Cad	APN	5	31054986	missense	probably benign	0.00
PIT4696001:Cad	UTSW	5	31072094	missense	probably damaging	0.99
R0317:Cad	UTSW	5	31072321	missense	probably benign	0.01
R0335:Cad	UTSW	5	31073985	unclassified	probably benign
R0401:Cad	UTSW	5	31073986	unclassified	probably benign
R0445:Cad	UTSW	5	31072709	missense	probably benign	0.08
R0494:Cad	UTSW	5	31077512	unclassified	probably benign
R0532:Cad	UTSW	5	31062187	splice site	probably benign
R0539:Cad	UTSW	5	31075457	splice site	probably benign
R0578:Cad	UTSW	5	31058776	missense	probably benign	0.01
R0590:Cad	UTSW	5	31062231	missense	probably damaging	1.00
R0638:Cad	UTSW	5	31077688	missense	probably damaging	0.98
R0831:Cad	UTSW	5	31067600	missense	probably damaging	1.00
R1329:Cad	UTSW	5	31059582	missense	probably damaging	1.00
R1513:Cad	UTSW	5	31068762	missense	probably damaging	1.00
R1531:Cad	UTSW	5	31076219	missense	probably benign	0.14
R1763:Cad	UTSW	5	31060951	missense	probably damaging	1.00
R1785:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R1786:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2131:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2165:Cad	UTSW	5	31062220	missense	probably damaging	1.00
R3103:Cad	UTSW	5	31061674	missense	possibly damaging	0.95
R3113:Cad	UTSW	5	31074137	missense	possibly damaging	0.50
R3762:Cad	UTSW	5	31075546	splice site	probably null
R3847:Cad	UTSW	5	31061650	missense	probably damaging	1.00
R3898:Cad	UTSW	5	31074022	missense	probably benign	0.06
R3943:Cad	UTSW	5	31072385	critical splice donor site	probably null
R4213:Cad	UTSW	5	31072344	missense	probably benign	0.01
R4458:Cad	UTSW	5	31061226	missense	probably damaging	1.00
R4562:Cad	UTSW	5	31058133	missense	possibly damaging	0.82
R4629:Cad	UTSW	5	31070295	missense	probably damaging	1.00
R4717:Cad	UTSW	5	31066686	critical splice acceptor site	probably null
R4811:Cad	UTSW	5	31074690	missense	probably benign	0.02
R5044:Cad	UTSW	5	31055021	missense	probably benign	0.00
R5630:Cad	UTSW	5	31060573	missense	probably damaging	1.00
R5660:Cad	UTSW	5	31076847	missense	probably damaging	1.00
R6008:Cad	UTSW	5	31069112	missense	probably damaging	1.00
R6029:Cad	UTSW	5	31054983	missense	possibly damaging	0.65
R6073:Cad	UTSW	5	31062562	missense	possibly damaging	0.84
R6240:Cad	UTSW	5	31072978	missense	probably benign	0.00
R6260:Cad	UTSW	5	31066800	missense	probably null
R7145:Cad	UTSW	5	31067612	missense	possibly damaging	0.89
R7303:Cad	UTSW	5	31060213	critical splice donor site	probably null
R7352:Cad	UTSW	5	31058078	missense	probably damaging	1.00
R7382:Cad	UTSW	5	31075829	missense	probably benign
R7387:Cad	UTSW	5	31061940	missense	probably damaging	1.00
R7455:Cad	UTSW	5	31074162	missense	probably damaging	0.99
R7596:Cad	UTSW	5	31069048	missense	probably benign
R7627:Cad	UTSW	5	31060164	missense	probably damaging	1.00
R7898:Cad	UTSW	5	31061485	missense	probably damaging	1.00
R8022:Cad	UTSW	5	31068806	missense	probably damaging	1.00
R8115:Cad	UTSW	5	31060927	missense	possibly damaging	0.82
R8511:Cad	UTSW	5	31075821	missense	probably benign	0.00
R8523:Cad	UTSW	5	31058106	missense	probably damaging	0.98
R8690:Cad	UTSW	5	31075156	missense	possibly damaging	0.58
R8697:Cad	UTSW	5	31074601	missense	probably benign	0.06
R8698:Cad	UTSW	5	31077475	missense	probably benign
R8699:Cad	UTSW	5	31076261	missense	possibly damaging	0.80
R8803:Cad	UTSW	5	31069564	missense	probably damaging	1.00
R9262:Cad	UTSW	5	31067665	missense	probably null
R9272:Cad	UTSW	5	31061232	missense	possibly damaging	0.91
R9287:Cad	UTSW	5	31072656	missense	possibly damaging	0.67
R9314:Cad	UTSW	5	31077644	missense	probably damaging	1.00
R9609:Cad	UTSW	5	31070674	critical splice donor site	probably null
R9665:Cad	UTSW	5	31072359	missense	probably benign	0.28
RF001:Cad	UTSW	5	31060212	critical splice donor site	probably benign
RF012:Cad	UTSW	5	31060212	critical splice donor site	probably benign
X0021:Cad	UTSW	5	31068131	missense	probably null	1.00
X0022:Cad	UTSW	5	31072317	missense	probably damaging	0.99
Z1177:Cad	UTSW	5	31068421	missense	probably damaging	1.00
Z1177:Cad	UTSW	5	31075128	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TTAAGTTCCAGGTCCCAAGGTTGC -3'
(R):5'- TTGTCTGCTAAGTGTGCTGCCC -3'

Sequencing Primer
(F):5'- GAAGTCTCTAATGGAGTCCCTAC -3'
(R):5'- AAGCTGGGACCTAGAAACGG -3'

Posted On

2013-05-09