Incidental Mutation 'R0212:Cad'
ID33528
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms
MMRRC Submission 038463-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0212 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31054780-31078479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31078110 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2137 (D2137G)
Ref Sequence ENSEMBL: ENSMUSP00000144009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202795] [ENSMUST00000202973]
Predicted Effect probably damaging
Transcript: ENSMUST00000013773
AA Change: D2198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: D2198G

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200917
Predicted Effect probably damaging
Transcript: ENSMUST00000200953
AA Change: D2135G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: D2135G

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000201182
AA Change: D2127G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: D2127G

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202795
AA Change: D2137G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: D2137G

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202827
Predicted Effect probably benign
Transcript: ENSMUST00000202973
SMART Domains Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
SCOP:d1gkra1 1 84 4e-28 SMART
PDB:4C6N|A 1 119 4e-58 PDB
low complexity region 156 170 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,848,910 probably null Het
Adat1 T A 8: 111,987,208 D113V possibly damaging Het
Arhgap40 T G 2: 158,550,575 L656V probably damaging Het
Atg2a T C 19: 6,246,554 I330T probably damaging Het
Cd8a G A 6: 71,373,649 E33K probably benign Het
Cemip C A 7: 83,973,190 G594C probably damaging Het
Chd6 T A 2: 161,052,847 D31V probably damaging Het
Cmpk1 A T 4: 114,965,019 M111K possibly damaging Het
Crispld2 T G 8: 120,010,631 H40Q probably benign Het
Depdc5 A G 5: 32,912,242 T441A probably benign Het
Dpm1 T C 2: 168,227,494 N5S probably benign Het
Ercc4 A G 16: 13,123,332 probably null Het
Fam83f A T 15: 80,690,578 M229L probably benign Het
Fgd5 A T 6: 91,988,208 D474V probably damaging Het
Fgf21 G T 7: 45,614,102 P184Q probably benign Het
Fry A T 5: 150,496,397 D1008V probably damaging Het
Gjd2 T C 2: 114,011,472 T175A probably benign Het
Gphn C T 12: 78,637,552 T577I probably damaging Het
Ifi207 A T 1: 173,736,398 N18K possibly damaging Het
Ifne T C 4: 88,879,735 R149G possibly damaging Het
Ift80 A T 3: 68,940,173 L330H probably benign Het
Inpp4b A T 8: 81,770,917 H122L probably benign Het
Inpp5e T C 2: 26,408,340 probably null Het
Ism1 T C 2: 139,740,257 L163S probably benign Het
Itga11 T A 9: 62,745,969 V375E probably benign Het
Itpr3 T G 17: 27,089,319 F306V probably damaging Het
Kif19a A T 11: 114,784,910 I403F possibly damaging Het
Klf12 A T 14: 100,022,862 S144T probably benign Het
Lyst C T 13: 13,635,985 H747Y possibly damaging Het
Mccc2 A G 13: 99,954,655 Y445H probably benign Het
Mei1 G A 15: 82,095,931 probably null Het
Metap2 T A 10: 93,861,380 K479N probably damaging Het
Mief2 A T 11: 60,730,667 D62V probably damaging Het
Mtrf1 A G 14: 79,419,279 D407G probably benign Het
Myo3a A G 2: 22,291,848 R210G probably damaging Het
Nkx2-2 T C 2: 147,184,170 H216R probably damaging Het
Nos1 A G 5: 117,910,212 E694G possibly damaging Het
Nptn A T 9: 58,627,881 Y103F probably benign Het
Nrxn1 A G 17: 90,362,758 probably benign Het
Numbl T C 7: 27,280,759 S389P probably damaging Het
Olfr1155 A G 2: 87,943,091 F179S probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr152 C T 2: 87,783,482 P314L unknown Het
Olfr357 A T 2: 36,997,323 D171V probably damaging Het
Olfr357 T A 2: 36,997,632 V274E possibly damaging Het
Olfr44 C A 9: 39,485,088 S55I probably damaging Het
Olfr975 A G 9: 39,949,940 V277A probably benign Het
Osm T G 11: 4,238,465 S31A probably benign Het
Paqr4 T C 17: 23,738,320 M70V probably benign Het
Pikfyve T A 1: 65,262,905 Y1607N probably benign Het
Plec A C 15: 76,191,305 Y402* probably null Het
Polq A G 16: 37,066,854 K1631E probably damaging Het
Pou6f1 A G 15: 100,580,815 V129A possibly damaging Het
Prm2 A G 16: 10,791,599 probably benign Het
Prtn3 A G 10: 79,881,137 Y112C probably damaging Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rps6ka5 A T 12: 100,553,169 probably null Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Slc10a1 A C 12: 80,967,712 L78R possibly damaging Het
Slc26a5 A T 5: 21,823,549 Y340* probably null Het
Sptbn2 T C 19: 4,746,942 probably null Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tmem131l A T 3: 83,913,268 S1226T probably benign Het
Togaram2 C T 17: 71,724,983 L866F probably damaging Het
Txndc17 A G 11: 72,207,732 T37A probably benign Het
Vmn2r105 C A 17: 20,208,565 V750F possibly damaging Het
Vmn2r54 T A 7: 12,632,497 Y170F probably benign Het
Wrnip1 T C 13: 32,821,906 V577A probably benign Het
Zc3h7b A G 15: 81,776,328 T226A probably benign Het
Zfp948 T C 17: 21,588,160 I538T probably benign Het
Zzef1 A G 11: 72,873,910 E1401G possibly damaging Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31061484 missense probably damaging 1.00
IGL00908:Cad APN 5 31059054 missense possibly damaging 0.93
IGL01068:Cad APN 5 31061770 splice site probably benign
IGL01638:Cad APN 5 31067614 missense probably damaging 1.00
IGL02483:Cad APN 5 31060826 critical splice acceptor site probably null
IGL02499:Cad APN 5 31069604 missense probably damaging 1.00
IGL02691:Cad APN 5 31055294 missense probably damaging 1.00
IGL03002:Cad APN 5 31054986 missense probably benign 0.00
PIT4696001:Cad UTSW 5 31072094 missense probably damaging 0.99
R0317:Cad UTSW 5 31072321 missense probably benign 0.01
R0335:Cad UTSW 5 31073985 unclassified probably benign
R0401:Cad UTSW 5 31073986 unclassified probably benign
R0445:Cad UTSW 5 31072709 missense probably benign 0.08
R0494:Cad UTSW 5 31077512 unclassified probably benign
R0532:Cad UTSW 5 31062187 splice site probably benign
R0539:Cad UTSW 5 31075457 splice site probably benign
R0578:Cad UTSW 5 31058776 missense probably benign 0.01
R0590:Cad UTSW 5 31062231 missense probably damaging 1.00
R0638:Cad UTSW 5 31077688 missense probably damaging 0.98
R0831:Cad UTSW 5 31067600 missense probably damaging 1.00
R1329:Cad UTSW 5 31059582 missense probably damaging 1.00
R1513:Cad UTSW 5 31068762 missense probably damaging 1.00
R1531:Cad UTSW 5 31076219 missense probably benign 0.14
R1763:Cad UTSW 5 31060951 missense probably damaging 1.00
R1785:Cad UTSW 5 31058072 missense probably damaging 1.00
R1786:Cad UTSW 5 31058072 missense probably damaging 1.00
R2131:Cad UTSW 5 31058072 missense probably damaging 1.00
R2165:Cad UTSW 5 31062220 missense probably damaging 1.00
R3103:Cad UTSW 5 31061674 missense possibly damaging 0.95
R3113:Cad UTSW 5 31074137 missense possibly damaging 0.50
R3762:Cad UTSW 5 31075546 intron probably null
R3847:Cad UTSW 5 31061650 missense probably damaging 1.00
R3898:Cad UTSW 5 31074022 missense probably benign 0.06
R3943:Cad UTSW 5 31072385 critical splice donor site probably null
R4213:Cad UTSW 5 31072344 missense probably benign 0.01
R4458:Cad UTSW 5 31061226 missense probably damaging 1.00
R4562:Cad UTSW 5 31058133 missense possibly damaging 0.82
R4629:Cad UTSW 5 31070295 missense probably damaging 1.00
R4717:Cad UTSW 5 31066686 critical splice acceptor site probably null
R4811:Cad UTSW 5 31074690 missense probably benign 0.02
R5044:Cad UTSW 5 31055021 missense probably benign 0.00
R5630:Cad UTSW 5 31060573 missense probably damaging 1.00
R5660:Cad UTSW 5 31076847 missense probably damaging 1.00
R6008:Cad UTSW 5 31069112 missense probably damaging 1.00
R6029:Cad UTSW 5 31054983 missense possibly damaging 0.65
R6073:Cad UTSW 5 31062562 missense possibly damaging 0.84
R6240:Cad UTSW 5 31072978 missense probably benign 0.00
R6260:Cad UTSW 5 31066800 missense probably null
R7145:Cad UTSW 5 31067612 missense possibly damaging 0.89
R7303:Cad UTSW 5 31060213 critical splice donor site probably null
R7352:Cad UTSW 5 31058078 missense probably damaging 1.00
R7382:Cad UTSW 5 31075829 missense probably benign
R7387:Cad UTSW 5 31061940 missense probably damaging 1.00
R7455:Cad UTSW 5 31074162 missense probably damaging 0.99
R7596:Cad UTSW 5 31069048 missense probably benign
R7627:Cad UTSW 5 31060164 missense probably damaging 1.00
R7898:Cad UTSW 5 31061485 missense probably damaging 1.00
R7981:Cad UTSW 5 31061485 missense probably damaging 1.00
R8022:Cad UTSW 5 31068806 missense probably damaging 1.00
RF001:Cad UTSW 5 31060212 critical splice donor site probably benign
RF012:Cad UTSW 5 31060212 critical splice donor site probably benign
X0021:Cad UTSW 5 31068131 missense probably null 1.00
X0022:Cad UTSW 5 31072317 missense probably damaging 0.99
Z1177:Cad UTSW 5 31068421 missense probably damaging 1.00
Z1177:Cad UTSW 5 31075128 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTAAGTTCCAGGTCCCAAGGTTGC -3'
(R):5'- TTGTCTGCTAAGTGTGCTGCCC -3'

Sequencing Primer
(F):5'- GAAGTCTCTAATGGAGTCCCTAC -3'
(R):5'- AAGCTGGGACCTAGAAACGG -3'
Posted On2013-05-09