Mutagenetix > Incidental Mutation

Incidental Mutation 'R0212:Vmn2r54'

33536

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r54

Ensembl Gene

ENSMUSG00000096593

Gene Name

vomeronasal 2, receptor 54

Synonyms

EG666085, Gm470, LOC232871, LOC385080

MMRRC Submission

038463-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R0212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12615233-12636134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12632497 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 170 (Y170F)

Ref Sequence

ENSEMBL: ENSMUSP00000083386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086210]

AlphaFold

A0A3B2W422

Predicted Effect

probably benign
Transcript: ENSMUST00000086210
AA Change: Y170F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000083386
Gene: ENSMUSG00000096593
AA Change: Y170F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	5	397	4.3e-58	PFAM
Pfam:NCD3G	442	495	2.2e-19	PFAM
Pfam:7tm_3	526	763	1.2e-54	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	G	A	5: 35,848,910		probably null	Het
Adat1	T	A	8: 111,987,208	D113V	possibly damaging	Het
Arhgap40	T	G	2: 158,550,575	L656V	probably damaging	Het
Atg2a	T	C	19: 6,246,554	I330T	probably damaging	Het
Cad	A	G	5: 31,078,110	D2137G	probably damaging	Het
Cd8a	G	A	6: 71,373,649	E33K	probably benign	Het
Cemip	C	A	7: 83,973,190	G594C	probably damaging	Het
Chd6	T	A	2: 161,052,847	D31V	probably damaging	Het
Cmpk1	A	T	4: 114,965,019	M111K	possibly damaging	Het
Crispld2	T	G	8: 120,010,631	H40Q	probably benign	Het
Depdc5	A	G	5: 32,912,242	T441A	probably benign	Het
Dpm1	T	C	2: 168,227,494	N5S	probably benign	Het
Ercc4	A	G	16: 13,123,332		probably null	Het
Fam83f	A	T	15: 80,690,578	M229L	probably benign	Het
Fgd5	A	T	6: 91,988,208	D474V	probably damaging	Het
Fgf21	G	T	7: 45,614,102	P184Q	probably benign	Het
Fry	A	T	5: 150,496,397	D1008V	probably damaging	Het
Gjd2	T	C	2: 114,011,472	T175A	probably benign	Het
Gphn	C	T	12: 78,637,552	T577I	probably damaging	Het
Ifi207	A	T	1: 173,736,398	N18K	possibly damaging	Het
Ifne	T	C	4: 88,879,735	R149G	possibly damaging	Het
Ift80	A	T	3: 68,940,173	L330H	probably benign	Het
Inpp4b	A	T	8: 81,770,917	H122L	probably benign	Het
Inpp5e	T	C	2: 26,408,340		probably null	Het
Ism1	T	C	2: 139,740,257	L163S	probably benign	Het
Itga11	T	A	9: 62,745,969	V375E	probably benign	Het
Itpr3	T	G	17: 27,089,319	F306V	probably damaging	Het
Kif19a	A	T	11: 114,784,910	I403F	possibly damaging	Het
Klf12	A	T	14: 100,022,862	S144T	probably benign	Het
Lyst	C	T	13: 13,635,985	H747Y	possibly damaging	Het
Mccc2	A	G	13: 99,954,655	Y445H	probably benign	Het
Mei1	G	A	15: 82,095,931		probably null	Het
Metap2	T	A	10: 93,861,380	K479N	probably damaging	Het
Mief2	A	T	11: 60,730,667	D62V	probably damaging	Het
Mtrf1	A	G	14: 79,419,279	D407G	probably benign	Het
Myo3a	A	G	2: 22,291,848	R210G	probably damaging	Het
Nkx2-2	T	C	2: 147,184,170	H216R	probably damaging	Het
Nos1	A	G	5: 117,910,212	E694G	possibly damaging	Het
Nptn	A	T	9: 58,627,881	Y103F	probably benign	Het
Nrxn1	A	G	17: 90,362,758		probably benign	Het
Numbl	T	C	7: 27,280,759	S389P	probably damaging	Het
Olfr1155	A	G	2: 87,943,091	F179S	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr152	C	T	2: 87,783,482	P314L	unknown	Het
Olfr357	A	T	2: 36,997,323	D171V	probably damaging	Het
Olfr357	T	A	2: 36,997,632	V274E	possibly damaging	Het
Olfr44	C	A	9: 39,485,088	S55I	probably damaging	Het
Olfr975	A	G	9: 39,949,940	V277A	probably benign	Het
Osm	T	G	11: 4,238,465	S31A	probably benign	Het
Paqr4	T	C	17: 23,738,320	M70V	probably benign	Het
Pikfyve	T	A	1: 65,262,905	Y1607N	probably benign	Het
Plec	A	C	15: 76,191,305	Y402*	probably null	Het
Polq	A	G	16: 37,066,854	K1631E	probably damaging	Het
Pou6f1	A	G	15: 100,580,815	V129A	possibly damaging	Het
Prm2	A	G	16: 10,791,599		probably benign	Het
Prtn3	A	G	10: 79,881,137	Y112C	probably damaging	Het
Qrfp	T	A	2: 31,808,785	H45L	probably benign	Het
Rps6ka5	A	T	12: 100,553,169		probably null	Het
Rspo1	G	A	4: 124,991,397	R22Q	probably benign	Het
Slc10a1	A	C	12: 80,967,712	L78R	possibly damaging	Het
Slc26a5	A	T	5: 21,823,549	Y340*	probably null	Het
Sptbn2	T	C	19: 4,746,942		probably null	Het
St3gal6	C	A	16: 58,473,453	A238S	probably damaging	Het
St3gal6	G	T	16: 58,473,455	A237E	probably damaging	Het
Tmem131l	A	T	3: 83,913,268	S1226T	probably benign	Het
Togaram2	C	T	17: 71,724,983	L866F	probably damaging	Het
Txndc17	A	G	11: 72,207,732	T37A	probably benign	Het
Vmn2r105	C	A	17: 20,208,565	V750F	possibly damaging	Het
Wrnip1	T	C	13: 32,821,906	V577A	probably benign	Het
Zc3h7b	A	G	15: 81,776,328	T226A	probably benign	Het
Zfp948	T	C	17: 21,588,160	I538T	probably benign	Het
Zzef1	A	G	11: 72,873,910	E1401G	possibly damaging	Het

Other mutations in Vmn2r54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Vmn2r54	APN	7	12631913	splice site	probably benign
IGL01778:Vmn2r54	APN	7	12632082	missense	probably benign	0.07
IGL01998:Vmn2r54	APN	7	12615300	missense	probably benign
IGL02028:Vmn2r54	APN	7	12632161	missense	probably damaging	1.00
IGL02064:Vmn2r54	APN	7	12615606	missense	probably benign	0.02
IGL02238:Vmn2r54	APN	7	12635983	missense	probably damaging	1.00
IGL03062:Vmn2r54	APN	7	12632428	missense	probably damaging	0.98
IGL03120:Vmn2r54	APN	7	12615387	missense	probably damaging	1.00
PIT4453001:Vmn2r54	UTSW	7	12629742	missense	probably benign	0.06
R0360:Vmn2r54	UTSW	7	12615649	missense	probably damaging	1.00
R1646:Vmn2r54	UTSW	7	12632507	missense	probably damaging	1.00
R1673:Vmn2r54	UTSW	7	12616211	critical splice acceptor site	probably null
R1738:Vmn2r54	UTSW	7	12635888	missense	probably benign	0.00
R1856:Vmn2r54	UTSW	7	12632311	missense	probably benign
R2012:Vmn2r54	UTSW	7	12615877	missense	probably damaging	1.00
R2038:Vmn2r54	UTSW	7	12629710	missense	possibly damaging	0.94
R2160:Vmn2r54	UTSW	7	12615493	missense	probably benign	0.29
R2397:Vmn2r54	UTSW	7	12615651	missense	probably damaging	0.98
R2430:Vmn2r54	UTSW	7	12632006	missense	probably damaging	0.99
R2829:Vmn2r54	UTSW	7	12615690	missense	possibly damaging	0.62
R2975:Vmn2r54	UTSW	7	12635992	missense	possibly damaging	0.92
R3005:Vmn2r54	UTSW	7	12615294	missense	probably benign	0.28
R3725:Vmn2r54	UTSW	7	12632296	missense	probably benign	0.42
R4486:Vmn2r54	UTSW	7	12632272	nonsense	probably null
R4881:Vmn2r54	UTSW	7	12629671	missense	probably benign	0.00
R4907:Vmn2r54	UTSW	7	12616223	splice site	probably null
R5536:Vmn2r54	UTSW	7	12632416	missense	probably benign	0.03
R5637:Vmn2r54	UTSW	7	12615369	missense	probably benign	0.41
R5703:Vmn2r54	UTSW	7	12629667	missense	probably benign	0.22
R5769:Vmn2r54	UTSW	7	12615282	missense	possibly damaging	0.73
R5972:Vmn2r54	UTSW	7	12615352	missense	probably damaging	1.00
R5972:Vmn2r54	UTSW	7	12635947	missense	probably damaging	1.00
R5977:Vmn2r54	UTSW	7	12632216	missense	probably damaging	1.00
R6084:Vmn2r54	UTSW	7	12632278	missense	probably damaging	0.98
R6176:Vmn2r54	UTSW	7	12615981	missense	probably damaging	1.00
R6229:Vmn2r54	UTSW	7	12631956	missense	probably benign	0.00
R6371:Vmn2r54	UTSW	7	12615435	missense	probably damaging	1.00
R6374:Vmn2r54	UTSW	7	12615493	missense	probably damaging	1.00
R6804:Vmn2r54	UTSW	7	12629865	missense	probably benign
R6886:Vmn2r54	UTSW	7	12632153	missense	probably benign	0.02
R7041:Vmn2r54	UTSW	7	12629824	missense	probably damaging	0.99
R7058:Vmn2r54	UTSW	7	12615795	missense	possibly damaging	0.70
R7113:Vmn2r54	UTSW	7	12616074	missense	probably damaging	1.00
R7124:Vmn2r54	UTSW	7	12622151	missense	probably benign	0.00
R7126:Vmn2r54	UTSW	7	12632161	missense	possibly damaging	0.91
R7236:Vmn2r54	UTSW	7	12631990	missense	possibly damaging	0.84
R7337:Vmn2r54	UTSW	7	12622117	missense	probably benign	0.00
R7406:Vmn2r54	UTSW	7	12616223	splice site	probably null
R7634:Vmn2r54	UTSW	7	12615703	missense	probably damaging	1.00
R7793:Vmn2r54	UTSW	7	12632269	missense	probably damaging	0.98
R8139:Vmn2r54	UTSW	7	12615816	missense	possibly damaging	0.92
R8158:Vmn2r54	UTSW	7	12615961	missense	probably damaging	1.00
R8179:Vmn2r54	UTSW	7	12632091	nonsense	probably null
R8440:Vmn2r54	UTSW	7	12616086	missense	possibly damaging	0.72
R8712:Vmn2r54	UTSW	7	12635950	missense	probably benign	0.22
R8853:Vmn2r54	UTSW	7	12615855	missense	probably damaging	1.00
R8859:Vmn2r54	UTSW	7	12629775	missense	possibly damaging	0.70
R9146:Vmn2r54	UTSW	7	12632720	missense	probably benign	0.05
R9157:Vmn2r54	UTSW	7	12632128	missense	possibly damaging	0.93
R9344:Vmn2r54	UTSW	7	12632356	missense	probably benign
R9423:Vmn2r54	UTSW	7	12615514	missense	probably damaging	1.00
R9534:Vmn2r54	UTSW	7	12632166	missense	probably benign	0.03
R9632:Vmn2r54	UTSW	7	12629826	missense	possibly damaging	0.74
R9661:Vmn2r54	UTSW	7	12615239	missense	probably benign
R9710:Vmn2r54	UTSW	7	12629826	missense	possibly damaging	0.74
U24488:Vmn2r54	UTSW	7	12615429	missense	possibly damaging	0.84
X0066:Vmn2r54	UTSW	7	12615370	missense	probably damaging	1.00
Z1177:Vmn2r54	UTSW	7	12632108	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCAAATGTGCCTTGCAACACC -3'
(R):5'- GGCTCTTCCTTGACAGGTCAGTTAC -3'

Sequencing Primer
(F):5'- CTTGCAACACCTGGGAAATG -3'
(R):5'- TACCCAGTCTGAGTGACAAGATTC -3'

Posted On

2013-05-09