Mutagenetix > Incidental Mutation

Incidental Mutation 'R0212:Osm'

33553

Institutional Source

Beutler Lab

Gene Symbol

Osm

Ensembl Gene

ENSMUSG00000058755

Gene Name

oncostatin M

Synonyms

OncoM

MMRRC Submission

038463-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4236420-4241026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 4238465 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 31 (S31A)

Ref Sequence

ENSEMBL: ENSMUSP00000074708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075221]

AlphaFold

P53347

Predicted Effect

probably benign
Transcript: ENSMUST00000075221
AA Change: S31A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000074708
Gene: ENSMUSG00000058755
AA Change: S31A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LIF_OSM	28	183	7.44e-92	SMART
low complexity region	203	214	N/A	INTRINSIC
low complexity region	217	245	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131764

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leukemia inhibitory factor/oncostatin-M (LIF/OSM) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a secreted cytokine and growth regulator that inhibits the proliferation of a number of tumor cell lines. This protein also regulates the production of other cytokines, including interleukin 6, granulocyte-colony stimulating factor and granulocyte-macrophage colony stimulating factor in endothelial cells. This gene and the related gene, leukemia inhibitory factor, also present on chromosome 22, may have resulted from the duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice display decreased noxious responses in models of acute thermal, mechanical, chemical, and visceral pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	G	A	5: 35,848,910		probably null	Het
Adat1	T	A	8: 111,987,208	D113V	possibly damaging	Het
Arhgap40	T	G	2: 158,550,575	L656V	probably damaging	Het
Atg2a	T	C	19: 6,246,554	I330T	probably damaging	Het
Cad	A	G	5: 31,078,110	D2137G	probably damaging	Het
Cd8a	G	A	6: 71,373,649	E33K	probably benign	Het
Cemip	C	A	7: 83,973,190	G594C	probably damaging	Het
Chd6	T	A	2: 161,052,847	D31V	probably damaging	Het
Cmpk1	A	T	4: 114,965,019	M111K	possibly damaging	Het
Crispld2	T	G	8: 120,010,631	H40Q	probably benign	Het
Depdc5	A	G	5: 32,912,242	T441A	probably benign	Het
Dpm1	T	C	2: 168,227,494	N5S	probably benign	Het
Ercc4	A	G	16: 13,123,332		probably null	Het
Fam83f	A	T	15: 80,690,578	M229L	probably benign	Het
Fgd5	A	T	6: 91,988,208	D474V	probably damaging	Het
Fgf21	G	T	7: 45,614,102	P184Q	probably benign	Het
Fry	A	T	5: 150,496,397	D1008V	probably damaging	Het
Gjd2	T	C	2: 114,011,472	T175A	probably benign	Het
Gphn	C	T	12: 78,637,552	T577I	probably damaging	Het
Ifi207	A	T	1: 173,736,398	N18K	possibly damaging	Het
Ifne	T	C	4: 88,879,735	R149G	possibly damaging	Het
Ift80	A	T	3: 68,940,173	L330H	probably benign	Het
Inpp4b	A	T	8: 81,770,917	H122L	probably benign	Het
Inpp5e	T	C	2: 26,408,340		probably null	Het
Ism1	T	C	2: 139,740,257	L163S	probably benign	Het
Itga11	T	A	9: 62,745,969	V375E	probably benign	Het
Itpr3	T	G	17: 27,089,319	F306V	probably damaging	Het
Kif19a	A	T	11: 114,784,910	I403F	possibly damaging	Het
Klf12	A	T	14: 100,022,862	S144T	probably benign	Het
Lyst	C	T	13: 13,635,985	H747Y	possibly damaging	Het
Mccc2	A	G	13: 99,954,655	Y445H	probably benign	Het
Mei1	G	A	15: 82,095,931		probably null	Het
Metap2	T	A	10: 93,861,380	K479N	probably damaging	Het
Mief2	A	T	11: 60,730,667	D62V	probably damaging	Het
Mtrf1	A	G	14: 79,419,279	D407G	probably benign	Het
Myo3a	A	G	2: 22,291,848	R210G	probably damaging	Het
Nkx2-2	T	C	2: 147,184,170	H216R	probably damaging	Het
Nos1	A	G	5: 117,910,212	E694G	possibly damaging	Het
Nptn	A	T	9: 58,627,881	Y103F	probably benign	Het
Nrxn1	A	G	17: 90,362,758		probably benign	Het
Numbl	T	C	7: 27,280,759	S389P	probably damaging	Het
Olfr1155	A	G	2: 87,943,091	F179S	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr152	C	T	2: 87,783,482	P314L	unknown	Het
Olfr357	A	T	2: 36,997,323	D171V	probably damaging	Het
Olfr357	T	A	2: 36,997,632	V274E	possibly damaging	Het
Olfr44	C	A	9: 39,485,088	S55I	probably damaging	Het
Olfr975	A	G	9: 39,949,940	V277A	probably benign	Het
Paqr4	T	C	17: 23,738,320	M70V	probably benign	Het
Pikfyve	T	A	1: 65,262,905	Y1607N	probably benign	Het
Plec	A	C	15: 76,191,305	Y402*	probably null	Het
Polq	A	G	16: 37,066,854	K1631E	probably damaging	Het
Pou6f1	A	G	15: 100,580,815	V129A	possibly damaging	Het
Prm2	A	G	16: 10,791,599		probably benign	Het
Prtn3	A	G	10: 79,881,137	Y112C	probably damaging	Het
Qrfp	T	A	2: 31,808,785	H45L	probably benign	Het
Rps6ka5	A	T	12: 100,553,169		probably null	Het
Rspo1	G	A	4: 124,991,397	R22Q	probably benign	Het
Slc10a1	A	C	12: 80,967,712	L78R	possibly damaging	Het
Slc26a5	A	T	5: 21,823,549	Y340*	probably null	Het
Sptbn2	T	C	19: 4,746,942		probably null	Het
St3gal6	C	A	16: 58,473,453	A238S	probably damaging	Het
St3gal6	G	T	16: 58,473,455	A237E	probably damaging	Het
Tmem131l	A	T	3: 83,913,268	S1226T	probably benign	Het
Togaram2	C	T	17: 71,724,983	L866F	probably damaging	Het
Txndc17	A	G	11: 72,207,732	T37A	probably benign	Het
Vmn2r105	C	A	17: 20,208,565	V750F	possibly damaging	Het
Vmn2r54	T	A	7: 12,632,497	Y170F	probably benign	Het
Wrnip1	T	C	13: 32,821,906	V577A	probably benign	Het
Zc3h7b	A	G	15: 81,776,328	T226A	probably benign	Het
Zfp948	T	C	17: 21,588,160	I538T	probably benign	Het
Zzef1	A	G	11: 72,873,910	E1401G	possibly damaging	Het

Other mutations in Osm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02007:Osm	APN	11	4239470	missense	probably damaging	0.99
IGL02477:Osm	APN	11	4239604	missense	probably damaging	0.99
IGL02478:Osm	APN	11	4239507	missense	probably damaging	0.96
IGL02699:Osm	APN	11	4239723	missense	possibly damaging	0.45
IGL03328:Osm	APN	11	4238426	missense	unknown
R0667:Osm	UTSW	11	4239918	missense	possibly damaging	0.53
R2237:Osm	UTSW	11	4238505	missense	possibly damaging	0.95
R4790:Osm	UTSW	11	4238435	missense	probably benign	0.01
R6621:Osm	UTSW	11	4239541	missense	probably benign	0.03
R7148:Osm	UTSW	11	4239936	missense	probably benign	0.02
R8669:Osm	UTSW	11	4239665	missense	probably benign	0.04
R8805:Osm	UTSW	11	4239839	missense	probably benign	0.18
R9205:Osm	UTSW	11	4238504	missense	possibly damaging	0.95
R9673:Osm	UTSW	11	4239926	missense	probably benign	0.00
T0975:Osm	UTSW	11	4239588	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCAGTGAGTGCTTCTGTGCAAACC -3'
(R):5'- CTGCTGCATCTGGGAACCTAGAAC -3'

Sequencing Primer
(F):5'- ACCCAGACCCTACTGTGTG -3'
(R):5'- ggtggtggtggtggtgg -3'

Posted On

2013-05-09