Incidental Mutation 'R0212:Slc10a1'
ID 33561
Institutional Source Beutler Lab
Gene Symbol Slc10a1
Ensembl Gene ENSMUSG00000021135
Gene Name solute carrier family 10 (sodium/bile acid cotransporter family), member 1
Synonyms sodium bile acid cotransporting polypeptide, Ntcp
MMRRC Submission 038463-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0212 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 80999959-81015479 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 81014486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 78 (L78R)
Ref Sequence ENSEMBL: ENSMUSP00000151215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095572] [ENSMUST00000218162] [ENSMUST00000218342] [ENSMUST00000220266]
AlphaFold O08705
Predicted Effect probably benign
Transcript: ENSMUST00000095572
AA Change: L78R

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135
AA Change: L78R

DomainStartEndE-ValueType
Pfam:SBF 32 217 3.3e-47 PFAM
transmembrane domain 222 244 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218162
AA Change: L78R

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218342
AA Change: L78R

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000220266
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 36,006,254 (GRCm39) probably null Het
Adat1 T A 8: 112,713,840 (GRCm39) D113V possibly damaging Het
Arhgap40 T G 2: 158,392,495 (GRCm39) L656V probably damaging Het
Atg2a T C 19: 6,296,584 (GRCm39) I330T probably damaging Het
Cad A G 5: 31,235,454 (GRCm39) D2137G probably damaging Het
Cd8a G A 6: 71,350,633 (GRCm39) E33K probably benign Het
Cemip C A 7: 83,622,398 (GRCm39) G594C probably damaging Het
Chd6 T A 2: 160,894,767 (GRCm39) D31V probably damaging Het
Cmpk1 A T 4: 114,822,216 (GRCm39) M111K possibly damaging Het
Crispld2 T G 8: 120,737,370 (GRCm39) H40Q probably benign Het
Depdc5 A G 5: 33,069,586 (GRCm39) T441A probably benign Het
Dpm1 T C 2: 168,069,414 (GRCm39) N5S probably benign Het
Ercc4 A G 16: 12,941,196 (GRCm39) probably null Het
Fam83f A T 15: 80,574,779 (GRCm39) M229L probably benign Het
Fgd5 A T 6: 91,965,189 (GRCm39) D474V probably damaging Het
Fgf21 G T 7: 45,263,526 (GRCm39) P184Q probably benign Het
Fry A T 5: 150,419,862 (GRCm39) D1008V probably damaging Het
Gjd2 T C 2: 113,841,953 (GRCm39) T175A probably benign Het
Gphn C T 12: 78,684,326 (GRCm39) T577I probably damaging Het
Ifi207 A T 1: 173,563,964 (GRCm39) N18K possibly damaging Het
Ifne T C 4: 88,797,972 (GRCm39) R149G possibly damaging Het
Ift80 A T 3: 68,847,506 (GRCm39) L330H probably benign Het
Inpp4b A T 8: 82,497,546 (GRCm39) H122L probably benign Het
Inpp5e T C 2: 26,298,352 (GRCm39) probably null Het
Ism1 T C 2: 139,582,177 (GRCm39) L163S probably benign Het
Itga11 T A 9: 62,653,251 (GRCm39) V375E probably benign Het
Itpr3 T G 17: 27,308,293 (GRCm39) F306V probably damaging Het
Kif19a A T 11: 114,675,736 (GRCm39) I403F possibly damaging Het
Klf12 A T 14: 100,260,298 (GRCm39) S144T probably benign Het
Lyst C T 13: 13,810,570 (GRCm39) H747Y possibly damaging Het
Mccc2 A G 13: 100,091,163 (GRCm39) Y445H probably benign Het
Mei1 G A 15: 81,980,132 (GRCm39) probably null Het
Metap2 T A 10: 93,697,242 (GRCm39) K479N probably damaging Het
Mief2 A T 11: 60,621,493 (GRCm39) D62V probably damaging Het
Mtrf1 A G 14: 79,656,719 (GRCm39) D407G probably benign Het
Myo3a A G 2: 22,296,659 (GRCm39) R210G probably damaging Het
Nkx2-2 T C 2: 147,026,090 (GRCm39) H216R probably damaging Het
Nos1 A G 5: 118,048,277 (GRCm39) E694G possibly damaging Het
Nptn A T 9: 58,535,164 (GRCm39) Y103F probably benign Het
Nrxn1 A G 17: 90,670,186 (GRCm39) probably benign Het
Numbl T C 7: 26,980,184 (GRCm39) S389P probably damaging Het
Or10d5 A G 9: 39,861,236 (GRCm39) V277A probably benign Het
Or1q1 T A 2: 36,887,644 (GRCm39) V274E possibly damaging Het
Or1q1 A T 2: 36,887,335 (GRCm39) D171V probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or5d16 A G 2: 87,773,435 (GRCm39) F179S probably damaging Het
Or5i1 C T 2: 87,613,826 (GRCm39) P314L unknown Het
Or8g20 C A 9: 39,396,384 (GRCm39) S55I probably damaging Het
Osm T G 11: 4,188,465 (GRCm39) S31A probably benign Het
Paqr4 T C 17: 23,957,294 (GRCm39) M70V probably benign Het
Pikfyve T A 1: 65,302,064 (GRCm39) Y1607N probably benign Het
Plec A C 15: 76,075,505 (GRCm39) Y402* probably null Het
Polq A G 16: 36,887,216 (GRCm39) K1631E probably damaging Het
Pou6f1 A G 15: 100,478,696 (GRCm39) V129A possibly damaging Het
Prm2 A G 16: 10,609,463 (GRCm39) probably benign Het
Prtn3 A G 10: 79,716,971 (GRCm39) Y112C probably damaging Het
Qrfp T A 2: 31,698,797 (GRCm39) H45L probably benign Het
Rps6ka5 A T 12: 100,519,428 (GRCm39) probably null Het
Rspo1 G A 4: 124,885,190 (GRCm39) R22Q probably benign Het
Slc26a5 A T 5: 22,028,547 (GRCm39) Y340* probably null Het
Sptbn2 T C 19: 4,796,970 (GRCm39) probably null Het
St3gal6 C A 16: 58,293,816 (GRCm39) A238S probably damaging Het
St3gal6 G T 16: 58,293,818 (GRCm39) A237E probably damaging Het
Tmem131l A T 3: 83,820,575 (GRCm39) S1226T probably benign Het
Togaram2 C T 17: 72,031,978 (GRCm39) L866F probably damaging Het
Txndc17 A G 11: 72,098,558 (GRCm39) T37A probably benign Het
Vmn2r105 C A 17: 20,428,827 (GRCm39) V750F possibly damaging Het
Vmn2r54 T A 7: 12,366,424 (GRCm39) Y170F probably benign Het
Wrnip1 T C 13: 33,005,889 (GRCm39) V577A probably benign Het
Zc3h7b A G 15: 81,660,529 (GRCm39) T226A probably benign Het
Zfp948 T C 17: 21,808,422 (GRCm39) I538T probably benign Het
Zzef1 A G 11: 72,764,736 (GRCm39) E1401G possibly damaging Het
Other mutations in Slc10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Slc10a1 APN 12 81,007,302 (GRCm39) missense probably benign 0.00
IGL02065:Slc10a1 APN 12 81,007,248 (GRCm39) missense possibly damaging 0.94
R1170:Slc10a1 UTSW 12 81,002,802 (GRCm39) missense probably damaging 1.00
R1261:Slc10a1 UTSW 12 81,014,604 (GRCm39) missense probably damaging 1.00
R1832:Slc10a1 UTSW 12 81,000,446 (GRCm39) missense probably benign 0.23
R2010:Slc10a1 UTSW 12 81,007,221 (GRCm39) missense probably benign 0.00
R2094:Slc10a1 UTSW 12 81,002,822 (GRCm39) missense possibly damaging 0.88
R2206:Slc10a1 UTSW 12 81,014,402 (GRCm39) missense probably damaging 0.99
R3905:Slc10a1 UTSW 12 81,014,441 (GRCm39) missense probably damaging 0.99
R4392:Slc10a1 UTSW 12 81,014,578 (GRCm39) missense probably damaging 1.00
R4413:Slc10a1 UTSW 12 81,004,906 (GRCm39) missense probably benign 0.01
R5173:Slc10a1 UTSW 12 81,002,802 (GRCm39) missense probably damaging 1.00
R5344:Slc10a1 UTSW 12 81,000,540 (GRCm39) missense possibly damaging 0.56
R7173:Slc10a1 UTSW 12 81,002,750 (GRCm39) missense probably damaging 1.00
R7253:Slc10a1 UTSW 12 81,004,958 (GRCm39) missense probably benign 0.16
R7413:Slc10a1 UTSW 12 81,007,396 (GRCm39) missense probably benign 0.00
R7990:Slc10a1 UTSW 12 81,000,554 (GRCm39) missense probably benign 0.01
R8879:Slc10a1 UTSW 12 81,014,369 (GRCm39) missense probably damaging 1.00
R9304:Slc10a1 UTSW 12 81,004,957 (GRCm39) missense probably benign 0.00
R9483:Slc10a1 UTSW 12 81,002,864 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCATGACATCTCGGCAGCAC -3'
(R):5'- ATGGAGGCGCACAACGTATCAG -3'

Sequencing Primer
(F):5'- CTCGGCAGCACCCCATC -3'
(R):5'- CAACGTATCAGCCCCCTTC -3'
Posted On 2013-05-09