Mutagenetix > Incidental Mutation

Incidental Mutation 'R0212:Slc10a1'

33561

Institutional Source

Beutler Lab

Gene Symbol

Slc10a1

Ensembl Gene

ENSMUSG00000021135

Gene Name

solute carrier family 10 (sodium/bile acid cotransporter family), member 1

Synonyms

Ntcp, sodium bile acid cotransporting polypeptide

MMRRC Submission

038463-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80953183-80968705 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 80967712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 78 (L78R)

Ref Sequence

ENSEMBL: ENSMUSP00000151215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095572] [ENSMUST00000218162] [ENSMUST00000218342] [ENSMUST00000220266]

AlphaFold

O08705

Predicted Effect

probably benign
Transcript: ENSMUST00000095572
AA Change: L78R

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135
AA Change: L78R

Domain	Start	End	E-Value	Type
Pfam:SBF	32	217	3.3e-47	PFAM
transmembrane domain	222	244	N/A	INTRINSIC
transmembrane domain	282	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218162
AA Change: L78R

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218342
AA Change: L78R

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000220266

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	G	A	5: 35,848,910		probably null	Het
Adat1	T	A	8: 111,987,208	D113V	possibly damaging	Het
Arhgap40	T	G	2: 158,550,575	L656V	probably damaging	Het
Atg2a	T	C	19: 6,246,554	I330T	probably damaging	Het
Cad	A	G	5: 31,078,110	D2137G	probably damaging	Het
Cd8a	G	A	6: 71,373,649	E33K	probably benign	Het
Cemip	C	A	7: 83,973,190	G594C	probably damaging	Het
Chd6	T	A	2: 161,052,847	D31V	probably damaging	Het
Cmpk1	A	T	4: 114,965,019	M111K	possibly damaging	Het
Crispld2	T	G	8: 120,010,631	H40Q	probably benign	Het
Depdc5	A	G	5: 32,912,242	T441A	probably benign	Het
Dpm1	T	C	2: 168,227,494	N5S	probably benign	Het
Ercc4	A	G	16: 13,123,332		probably null	Het
Fam83f	A	T	15: 80,690,578	M229L	probably benign	Het
Fgd5	A	T	6: 91,988,208	D474V	probably damaging	Het
Fgf21	G	T	7: 45,614,102	P184Q	probably benign	Het
Fry	A	T	5: 150,496,397	D1008V	probably damaging	Het
Gjd2	T	C	2: 114,011,472	T175A	probably benign	Het
Gphn	C	T	12: 78,637,552	T577I	probably damaging	Het
Ifi207	A	T	1: 173,736,398	N18K	possibly damaging	Het
Ifne	T	C	4: 88,879,735	R149G	possibly damaging	Het
Ift80	A	T	3: 68,940,173	L330H	probably benign	Het
Inpp4b	A	T	8: 81,770,917	H122L	probably benign	Het
Inpp5e	T	C	2: 26,408,340		probably null	Het
Ism1	T	C	2: 139,740,257	L163S	probably benign	Het
Itga11	T	A	9: 62,745,969	V375E	probably benign	Het
Itpr3	T	G	17: 27,089,319	F306V	probably damaging	Het
Kif19a	A	T	11: 114,784,910	I403F	possibly damaging	Het
Klf12	A	T	14: 100,022,862	S144T	probably benign	Het
Lyst	C	T	13: 13,635,985	H747Y	possibly damaging	Het
Mccc2	A	G	13: 99,954,655	Y445H	probably benign	Het
Mei1	G	A	15: 82,095,931		probably null	Het
Metap2	T	A	10: 93,861,380	K479N	probably damaging	Het
Mief2	A	T	11: 60,730,667	D62V	probably damaging	Het
Mtrf1	A	G	14: 79,419,279	D407G	probably benign	Het
Myo3a	A	G	2: 22,291,848	R210G	probably damaging	Het
Nkx2-2	T	C	2: 147,184,170	H216R	probably damaging	Het
Nos1	A	G	5: 117,910,212	E694G	possibly damaging	Het
Nptn	A	T	9: 58,627,881	Y103F	probably benign	Het
Nrxn1	A	G	17: 90,362,758		probably benign	Het
Numbl	T	C	7: 27,280,759	S389P	probably damaging	Het
Olfr1155	A	G	2: 87,943,091	F179S	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr152	C	T	2: 87,783,482	P314L	unknown	Het
Olfr357	A	T	2: 36,997,323	D171V	probably damaging	Het
Olfr357	T	A	2: 36,997,632	V274E	possibly damaging	Het
Olfr44	C	A	9: 39,485,088	S55I	probably damaging	Het
Olfr975	A	G	9: 39,949,940	V277A	probably benign	Het
Osm	T	G	11: 4,238,465	S31A	probably benign	Het
Paqr4	T	C	17: 23,738,320	M70V	probably benign	Het
Pikfyve	T	A	1: 65,262,905	Y1607N	probably benign	Het
Plec	A	C	15: 76,191,305	Y402*	probably null	Het
Polq	A	G	16: 37,066,854	K1631E	probably damaging	Het
Pou6f1	A	G	15: 100,580,815	V129A	possibly damaging	Het
Prm2	A	G	16: 10,791,599		probably benign	Het
Prtn3	A	G	10: 79,881,137	Y112C	probably damaging	Het
Qrfp	T	A	2: 31,808,785	H45L	probably benign	Het
Rps6ka5	A	T	12: 100,553,169		probably null	Het
Rspo1	G	A	4: 124,991,397	R22Q	probably benign	Het
Slc26a5	A	T	5: 21,823,549	Y340*	probably null	Het
Sptbn2	T	C	19: 4,746,942		probably null	Het
St3gal6	C	A	16: 58,473,453	A238S	probably damaging	Het
St3gal6	G	T	16: 58,473,455	A237E	probably damaging	Het
Tmem131l	A	T	3: 83,913,268	S1226T	probably benign	Het
Togaram2	C	T	17: 71,724,983	L866F	probably damaging	Het
Txndc17	A	G	11: 72,207,732	T37A	probably benign	Het
Vmn2r105	C	A	17: 20,208,565	V750F	possibly damaging	Het
Vmn2r54	T	A	7: 12,632,497	Y170F	probably benign	Het
Wrnip1	T	C	13: 32,821,906	V577A	probably benign	Het
Zc3h7b	A	G	15: 81,776,328	T226A	probably benign	Het
Zfp948	T	C	17: 21,588,160	I538T	probably benign	Het
Zzef1	A	G	11: 72,873,910	E1401G	possibly damaging	Het

Other mutations in Slc10a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01870:Slc10a1	APN	12	80960528	missense	probably benign	0.00
IGL02065:Slc10a1	APN	12	80960474	missense	possibly damaging	0.94
R1170:Slc10a1	UTSW	12	80956028	missense	probably damaging	1.00
R1261:Slc10a1	UTSW	12	80967830	missense	probably damaging	1.00
R1832:Slc10a1	UTSW	12	80953672	missense	probably benign	0.23
R2010:Slc10a1	UTSW	12	80960447	missense	probably benign	0.00
R2094:Slc10a1	UTSW	12	80956048	missense	possibly damaging	0.88
R2206:Slc10a1	UTSW	12	80967628	missense	probably damaging	0.99
R3905:Slc10a1	UTSW	12	80967667	missense	probably damaging	0.99
R4392:Slc10a1	UTSW	12	80967804	missense	probably damaging	1.00
R4413:Slc10a1	UTSW	12	80958132	missense	probably benign	0.01
R5173:Slc10a1	UTSW	12	80956028	missense	probably damaging	1.00
R5344:Slc10a1	UTSW	12	80953766	missense	possibly damaging	0.56
R7173:Slc10a1	UTSW	12	80955976	missense	probably damaging	1.00
R7253:Slc10a1	UTSW	12	80958184	missense	probably benign	0.16
R7413:Slc10a1	UTSW	12	80960622	missense	probably benign	0.00
R7990:Slc10a1	UTSW	12	80953780	missense	probably benign	0.01
R8879:Slc10a1	UTSW	12	80967595	missense	probably damaging	1.00
R9304:Slc10a1	UTSW	12	80958183	missense	probably benign	0.00
R9483:Slc10a1	UTSW	12	80956090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCATGACATCTCGGCAGCAC -3'
(R):5'- ATGGAGGCGCACAACGTATCAG -3'

Sequencing Primer
(F):5'- CTCGGCAGCACCCCATC -3'
(R):5'- CAACGTATCAGCCCCCTTC -3'

Posted On

2013-05-09