Incidental Mutation 'R0217:Actr3'
ID33594
Institutional Source Beutler Lab
Gene Symbol Actr3
Ensembl Gene ENSMUSG00000026341
Gene NameARP3 actin-related protein 3
Synonyms1200003A09Rik, Arp3
MMRRC Submission 038466-MU
Accession Numbers

Ncbi RefSeq: NM_023735.2, NM_001205385.1, NM_001205386.1; MGI: 1921367

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0217 (G1)
Quality Score188
Status Validated (trace)
Chromosome1
Chromosomal Location125392905-125435727 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 125407413 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027579] [ENSMUST00000178474] [ENSMUST00000185280] [ENSMUST00000187460] [ENSMUST00000188497] [ENSMUST00000191004] [ENSMUST00000191544] [ENSMUST00000191578]
Predicted Effect probably benign
Transcript: ENSMUST00000027579
SMART Domains Protein: ENSMUSP00000027579
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 5 413 1.62e-186 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178474
SMART Domains Protein: ENSMUSP00000137503
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 5 413 1.62e-186 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185280
SMART Domains Protein: ENSMUSP00000140082
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
Pfam:Actin 1 70 2.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187460
SMART Domains Protein: ENSMUSP00000140000
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 5 161 3.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188497
SMART Domains Protein: ENSMUSP00000140535
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 5 216 7.6e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189192
Predicted Effect probably benign
Transcript: ENSMUST00000191004
SMART Domains Protein: ENSMUSP00000140953
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
Pfam:Actin 2 129 2.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191544
SMART Domains Protein: ENSMUSP00000139674
Gene: ENSMUSG00000026341

DomainStartEndE-ValueType
ACTIN 1 155 2.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191578
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype Strain: 3765916
Lethality: E3-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele die prior to E4.5 and exhibit abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Actr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Actr3 APN 1 125397229 missense probably benign 0.00
IGL00574:Actr3 APN 1 125411274 missense probably damaging 1.00
IGL00715:Actr3 APN 1 125395076 missense probably damaging 0.96
IGL01139:Actr3 APN 1 125405885 missense probably damaging 1.00
IGL01897:Actr3 APN 1 125418288 missense possibly damaging 0.54
P0023:Actr3 UTSW 1 125395066 critical splice donor site probably null
R0660:Actr3 UTSW 1 125408567 missense probably benign 0.40
R1494:Actr3 UTSW 1 125416281 missense probably benign 0.06
R1582:Actr3 UTSW 1 125405925 missense probably benign 0.01
R1589:Actr3 UTSW 1 125408563 missense probably damaging 1.00
R3432:Actr3 UTSW 1 125394039 missense probably damaging 1.00
R5810:Actr3 UTSW 1 125416379 intron probably benign
R6089:Actr3 UTSW 1 125407395 missense probably damaging 1.00
R6276:Actr3 UTSW 1 125395137 missense probably benign
R7120:Actr3 UTSW 1 125403432 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGAGATCCTCATGCAGTCAGTGATG -3'
(R):5'- CACTCTTGCTTGTGGCTCTAGGAAG -3'

Sequencing Primer
(F):5'- AGAGCTTCCAGTCTTGTAAAGGTC -3'
(R):5'- TGGCTCTAGGAAGAGAGCG -3'
Posted On2013-05-09