Mutagenetix > Incidental Mutations

Incidental Mutation 'R0217:Adamts13'

33597

Institutional Source

Beutler Lab

Gene Symbol

Adamts13

Ensembl Gene

ENSMUSG00000014852

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13

Synonyms

vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028

MMRRC Submission

038466-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R0217 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

26973416-27009628 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 26996921 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]

Predicted Effect

probably benign
Transcript: ENSMUST00000014996

SMART Domains

Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	2.3e-11	PFAM
Pfam:Reprolysin	84	291	1e-15	PFAM
Pfam:Reprolysin_3	113	237	2e-10	PFAM
Pfam:Reprolysin_2	132	281	5e-9	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102891

SMART Domains

Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	8.5e-11	PFAM
Pfam:Reprolysin	96	291	4.9e-14	PFAM
Pfam:Reprolysin_3	106	237	5.6e-11	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART
Blast:TSP1	1022	1079	4e-26	BLAST
TSP1	1081	1137	4.58e-4	SMART
Blast:CUB	1196	1293	2e-39	BLAST
Blast:CUB	1303	1412	3e-63	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr3	A	G	1: 125,407,413		probably benign	Het
Afap1l1	A	G	18: 61,746,869	V310A	probably damaging	Het
Alms1	T	A	6: 85,622,930	S2048R	probably damaging	Het
Aspm	T	A	1: 139,457,880	S421T	possibly damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc150	T	G	1: 54,300,430	S478A	possibly damaging	Het
Ccnyl1	T	A	1: 64,713,098		probably benign	Het
Cdc23	T	C	18: 34,651,665	T15A	unknown	Het
Cdk19	C	T	10: 40,476,258		probably benign	Het
Comp	A	C	8: 70,378,908	D420A	probably damaging	Het
Ctnnal1	T	C	4: 56,813,230	H667R	probably benign	Het
Cyp20a1	C	A	1: 60,343,466		probably benign	Het
Eci3	A	C	13: 34,948,089	S259A	probably benign	Het
Fcnb	T	C	2: 28,079,677	D126G	probably benign	Het
Foxk1	T	C	5: 142,401,894	M124T	possibly damaging	Het
Gm12790	T	C	4: 101,968,034	Y61C	probably damaging	Het
Gm498	T	C	7: 143,894,219		probably benign	Het
Hmgcr	A	C	13: 96,651,980	I777S	probably damaging	Het
Hsdl2	A	G	4: 59,597,311	E100G	probably damaging	Het
Itgb2	G	T	10: 77,548,536		probably benign	Het
Jak2	T	A	19: 29,296,650		probably null	Het
Lrba	T	C	3: 86,642,722	S2333P	probably damaging	Het
Man1a2	A	G	3: 100,617,037	L365P	possibly damaging	Het
Map2k5	A	T	9: 63,256,975		probably null	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Megf8	T	A	7: 25,364,079	L2620Q	probably damaging	Het
Nf1	A	T	11: 79,428,574		probably benign	Het
Olfr390	T	A	11: 73,787,388	V150E	possibly damaging	Het
Olfr491	C	A	7: 108,317,298	H135N	probably benign	Het
Olfr746	A	G	14: 50,654,095	N286S	probably damaging	Het
Pank3	T	A	11: 35,777,728	D181E	probably benign	Het
Pip5k1a	A	G	3: 95,073,991		probably null	Het
Plag1	A	C	4: 3,904,379	S271A	probably benign	Het
Plxna2	T	A	1: 194,644,598	I280N	probably damaging	Het
Polr1a	T	C	6: 71,963,703	V1007A	probably benign	Het
Ppm1h	T	A	10: 122,920,735	D428E	probably damaging	Het
Prelid2	A	T	18: 41,935,252		probably benign	Het
Ptk2b	T	C	14: 66,156,381	Y881C	probably damaging	Het
Rptor	T	C	11: 119,894,912		probably benign	Het
Sbno1	T	C	5: 124,404,324		probably null	Het
Scaf4	T	C	16: 90,242,682	D843G	probably damaging	Het
Serpina3b	C	T	12: 104,130,727	A89V	probably damaging	Het
Serpinb9d	C	A	13: 33,198,022	T158N	possibly damaging	Het
Slc39a10	C	T	1: 46,835,540	V201I	probably benign	Het
Slc6a13	T	A	6: 121,324,320	N189K	probably damaging	Het
Smco1	G	T	16: 32,273,781	R90L	possibly damaging	Het
Stim1	T	A	7: 102,435,800	M653K	probably benign	Het
Stxbp1	T	C	2: 32,801,870	S437G	possibly damaging	Het
Stxbp3-ps	T	G	19: 9,559,132		noncoding transcript	Het
Tgtp1	A	C	11: 48,987,319	S186R	probably benign	Het
Trpc7	C	T	13: 56,789,768	W570*	probably null	Het
Trpv4	C	A	5: 114,634,661	R289L	possibly damaging	Het
Vmn2r82	A	G	10: 79,378,800	M206V	possibly damaging	Het
Wdr47	T	A	3: 108,637,020	V653E	probably damaging	Het
Zfp113	T	C	5: 138,150,691	R64G	probably benign	Het
Zfp661	C	T	2: 127,577,291	E310K	probably damaging	Het
Zfp735	T	A	11: 73,711,286	I352N	possibly damaging	Het
Zswim4	A	G	8: 84,212,664	L863P	probably damaging	Het
Zzef1	T	A	11: 72,889,068	I1889N	probably damaging	Het

Other mutations in Adamts13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adamts13	APN	2	27005361	missense	probably benign	0.04
IGL00465:Adamts13	APN	2	26973555	missense	probably benign	0.32
IGL01114:Adamts13	APN	2	27005190	missense	probably benign	0.41
IGL01138:Adamts13	APN	2	26983042	missense	probably damaging	1.00
IGL01154:Adamts13	APN	2	27006194	missense	probably benign
IGL01860:Adamts13	APN	2	26978011	missense	probably damaging	0.99
IGL01924:Adamts13	APN	2	26996583	missense	possibly damaging	0.80
IGL01991:Adamts13	APN	2	26990598	missense	probably damaging	0.97
IGL02215:Adamts13	APN	2	26985483	missense	probably damaging	1.00
IGL02415:Adamts13	APN	2	26989283	missense	possibly damaging	0.95
IGL02519:Adamts13	APN	2	26978675	missense	probably damaging	1.00
IGL02956:Adamts13	APN	2	26983037	missense	probably benign	0.18
IGL03209:Adamts13	APN	2	26992961	missense	probably benign	0.00
I1329:Adamts13	UTSW	2	26973619	missense	possibly damaging	0.52
IGL02837:Adamts13	UTSW	2	26991420	missense	probably benign	0.01
IGL03048:Adamts13	UTSW	2	26978699	critical splice donor site	probably null
R0041:Adamts13	UTSW	2	26983974	missense	probably damaging	1.00
R0276:Adamts13	UTSW	2	26975760	missense	possibly damaging	0.91
R0309:Adamts13	UTSW	2	26986989	missense	probably damaging	0.99
R0348:Adamts13	UTSW	2	26981080	missense	probably benign	0.13
R0369:Adamts13	UTSW	2	27005186	missense	probably benign	0.00
R0386:Adamts13	UTSW	2	26986679	splice site	probably null
R0553:Adamts13	UTSW	2	26991334	nonsense	probably null
R0714:Adamts13	UTSW	2	26986985	splice site	probably benign
R0862:Adamts13	UTSW	2	27006324	critical splice donor site	probably null
R1320:Adamts13	UTSW	2	26989246	missense	probably damaging	0.97
R1458:Adamts13	UTSW	2	26988354	missense	probably damaging	1.00
R1473:Adamts13	UTSW	2	26981753	nonsense	probably null
R1491:Adamts13	UTSW	2	26978315	missense	probably damaging	1.00
R1588:Adamts13	UTSW	2	26975675	missense	probably benign	0.01
R1638:Adamts13	UTSW	2	26996583	missense	possibly damaging	0.80
R1724:Adamts13	UTSW	2	26991294	missense	probably benign	0.00
R1924:Adamts13	UTSW	2	26984141	missense	probably damaging	1.00
R2001:Adamts13	UTSW	2	26973990	missense	probably benign
R2072:Adamts13	UTSW	2	27005425	missense	probably benign	0.10
R2073:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R2409:Adamts13	UTSW	2	26978362	missense	probably benign	0.00
R4362:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4363:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4422:Adamts13	UTSW	2	27005400	missense	probably benign	0.00
R4769:Adamts13	UTSW	2	27008711	nonsense	probably null
R4785:Adamts13	UTSW	2	26983042	missense	probably damaging	1.00
R4831:Adamts13	UTSW	2	26983130	critical splice donor site	probably null
R4832:Adamts13	UTSW	2	26989402	missense	probably benign	0.22
R4945:Adamts13	UTSW	2	26986610	missense	probably damaging	1.00
R5047:Adamts13	UTSW	2	26996910	missense	probably damaging	0.98
R5126:Adamts13	UTSW	2	26996915	critical splice donor site	probably null
R5161:Adamts13	UTSW	2	26993008	missense	probably benign	0.00
R5394:Adamts13	UTSW	2	26986558	missense	probably benign	0.00
R5557:Adamts13	UTSW	2	26973639	missense	probably benign	0.05
R5660:Adamts13	UTSW	2	26996749	missense	probably benign
R5890:Adamts13	UTSW	2	26986591	missense	probably damaging	0.96
R6168:Adamts13	UTSW	2	27004886	missense	probably benign	0.37
R6536:Adamts13	UTSW	2	26975750	missense	probably damaging	0.99
R6929:Adamts13	UTSW	2	27006263	nonsense	probably null
R7207:Adamts13	UTSW	2	26978695	missense	probably damaging	1.00
R7211:Adamts13	UTSW	2	26989298	missense	probably benign	0.40
R7212:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R7392:Adamts13	UTSW	2	26989324	missense	probably damaging	1.00
R7583:Adamts13	UTSW	2	26973953	missense	probably benign
R7604:Adamts13	UTSW	2	27005206	missense	probably benign	0.00
R7783:Adamts13	UTSW	2	26990585	missense	not run
R7814:Adamts13	UTSW	2	26996549	missense	probably benign
X0027:Adamts13	UTSW	2	26985546	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAAAATGCCTGTCCAGGAAGAGC -3'
(R):5'- AGACCCTGTCTGTCTAGTGAGCATC -3'

Sequencing Primer
(F):5'- CTGTCCAGGAAGAGCTATGC -3'
(R):5'- tttctaacatgcacaaagccc -3'

Posted On

2013-05-09