Incidental Mutation 'R0217:Fcnb'
ID 33598
Institutional Source Beutler Lab
Gene Symbol Fcnb
Ensembl Gene ENSMUSG00000026835
Gene Name ficolin B
Synonyms
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0217 (G1)
Quality Score 210
Status Validated (trace)
Chromosome 2
Chromosomal Location 28076378-28084885 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28079677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 126 (D126G)
Ref Sequence ENSEMBL: ENSMUSP00000112625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028179] [ENSMUST00000117486] [ENSMUST00000135472]
AlphaFold O70497
Predicted Effect probably benign
Transcript: ENSMUST00000028179
AA Change: D126G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028179
Gene: ENSMUSG00000026835
AA Change: D126G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 1.1e-11 PFAM
FBG 101 314 1.78e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117486
AA Change: D126G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112625
Gene: ENSMUSG00000026835
AA Change: D126G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 6.7e-12 PFAM
FBG 101 250 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135472
SMART Domains Protein: ENSMUSP00000119098
Gene: ENSMUSG00000026835

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 38 81 5.3e-10 PFAM
internal_repeat_1 86 107 1.19e-5 PROSPERO
Meta Mutation Damage Score 0.0983 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Streptococcus pneumoniae infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Fcnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Fcnb APN 2 28076801 missense probably benign 0.04
IGL02130:Fcnb APN 2 28084789 critical splice donor site probably null
IGL02348:Fcnb APN 2 28084830 missense possibly damaging 0.88
IGL02504:Fcnb APN 2 28076594 missense probably damaging 1.00
IGL03118:Fcnb APN 2 28076618 missense probably benign 0.06
IGL03179:Fcnb APN 2 28076634 missense possibly damaging 0.93
R0899:Fcnb UTSW 2 28076779 missense probably damaging 1.00
R3901:Fcnb UTSW 2 28079196 missense probably damaging 1.00
R5845:Fcnb UTSW 2 28079621 critical splice donor site probably null
R5911:Fcnb UTSW 2 28076689 missense probably damaging 1.00
R6065:Fcnb UTSW 2 28079910 missense probably damaging 1.00
R6188:Fcnb UTSW 2 28079190 missense possibly damaging 0.94
R6488:Fcnb UTSW 2 28078289 missense probably damaging 1.00
R8058:Fcnb UTSW 2 28079695 missense probably damaging 1.00
R8194:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8195:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8196:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8198:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8199:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8678:Fcnb UTSW 2 28078349 missense possibly damaging 0.61
R9224:Fcnb UTSW 2 28079148 missense probably damaging 1.00
R9261:Fcnb UTSW 2 28079624 missense probably damaging 0.99
X0024:Fcnb UTSW 2 28076691 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAACGTGTGCTCTCTCACACAG -3'
(R):5'- TGTGCTACAGGTGACCACATTGC -3'

Sequencing Primer
(F):5'- CTATCTTCAAAGAGTAAAGGGCTCC -3'
(R):5'- AGGTGACCACATTGCCTATC -3'
Posted On 2013-05-09