Incidental Mutation 'R0217:Zfp661'
Institutional Source Beutler Lab
Gene Symbol Zfp661
Ensembl Gene ENSMUSG00000034800
Gene Namezinc finger protein 661
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0217 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location127574662-127587094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127577291 bp
Amino Acid Change Glutamic Acid to Lysine at position 310 (E310K)
Ref Sequence ENSEMBL: ENSMUSP00000132820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077422] [ENSMUST00000110366] [ENSMUST00000110368] [ENSMUST00000164551]
Predicted Effect probably damaging
Transcript: ENSMUST00000077422
AA Change: E310K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076637
Gene: ENSMUSG00000034800
AA Change: E310K

KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110366
AA Change: E310K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105995
Gene: ENSMUSG00000034800
AA Change: E310K

KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110368
AA Change: E310K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105997
Gene: ENSMUSG00000034800
AA Change: E310K

KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164551
AA Change: E310K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132820
Gene: ENSMUSG00000034800
AA Change: E310K

KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Meta Mutation Damage Score 0.1853 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the C2H2-type zinc-finger protein family. The exact function of this gene is not known, however, zinc-finger proteins are known to interact with DNA and function as transcription regulators. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Zfp661
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Zfp661 UTSW 2 127578612 missense possibly damaging 0.93
R0402:Zfp661 UTSW 2 127577720 nonsense probably null
R4429:Zfp661 UTSW 2 127578708 missense probably damaging 0.96
R4689:Zfp661 UTSW 2 127577548 missense probably damaging 1.00
R4881:Zfp661 UTSW 2 127578644 missense probably benign 0.01
R5192:Zfp661 UTSW 2 127577062 missense possibly damaging 0.83
R5996:Zfp661 UTSW 2 127577048 missense probably damaging 0.97
R6074:Zfp661 UTSW 2 127577873 missense probably benign 0.00
R7062:Zfp661 UTSW 2 127577120 missense probably damaging 1.00
R7178:Zfp661 UTSW 2 127577536 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcctttccacactcgcc -3'
(R):5'- gccttctttgaccgttcatcc -3'
Posted On2013-05-09