Incidental Mutation 'R0217:Ctnnal1'
ID33606
Institutional Source Beutler Lab
Gene Symbol Ctnnal1
Ensembl Gene ENSMUSG00000038816
Gene Namecatenin (cadherin associated protein), alpha-like 1
SynonymsCatnal1, ACRP
MMRRC Submission 038466-MU
Accession Numbers

Genbank: NM_018761.3; Ensembl: ENSMUST00000045142, ENSMUST00000107612

Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R0217 (G1)
Quality Score216
Status Validated (trace)
Chromosome4
Chromosomal Location56810935-56865188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56813230 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 667 (H667R)
Ref Sequence ENSEMBL: ENSMUSP00000036487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045142] [ENSMUST00000045368] [ENSMUST00000131520]
Predicted Effect probably benign
Transcript: ENSMUST00000045142
AA Change: H667R

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036487
Gene: ENSMUSG00000038816
AA Change: H667R

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:Vinculin 30 309 7e-39 PFAM
Pfam:Vinculin 302 526 1.7e-12 PFAM
Pfam:Vinculin 531 683 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045368
SMART Domains Protein: ENSMUSP00000047275
Gene: ENSMUSG00000038827

DomainStartEndE-ValueType
Pfam:GCV_H 117 185 5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131231
Predicted Effect probably benign
Transcript: ENSMUST00000131520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134915
Meta Mutation Damage Score 0.1460 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and fertile and exhibit no overt phenotypes or defects in hematopoiesis and hematopoietic stem cell function. [provided by MGI curators]
Allele List at MGI

All alleles(111) : Targeted, other(2) Gene trapped(109)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Ctnnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Ctnnal1 APN 4 56829544 missense possibly damaging 0.90
IGL01404:Ctnnal1 APN 4 56829590 missense probably damaging 1.00
IGL01523:Ctnnal1 APN 4 56835243 missense probably damaging 1.00
IGL02413:Ctnnal1 APN 4 56835306 missense probably benign 0.19
IGL02618:Ctnnal1 APN 4 56817060 missense probably benign 0.07
IGL03109:Ctnnal1 APN 4 56839045 missense probably damaging 1.00
IGL03159:Ctnnal1 APN 4 56844599 missense probably benign 0.00
IGL03208:Ctnnal1 APN 4 56813833 missense probably benign 0.00
IGL03250:Ctnnal1 APN 4 56812356 missense probably benign 0.00
NA:Ctnnal1 UTSW 4 56817044 missense probably benign 0.02
R0391:Ctnnal1 UTSW 4 56847921 missense probably damaging 1.00
R0513:Ctnnal1 UTSW 4 56835348 missense probably benign 0.01
R0582:Ctnnal1 UTSW 4 56813228 missense probably damaging 1.00
R1434:Ctnnal1 UTSW 4 56847971 missense probably damaging 0.96
R1638:Ctnnal1 UTSW 4 56813856 missense probably benign 0.06
R1760:Ctnnal1 UTSW 4 56838988 missense probably damaging 1.00
R1871:Ctnnal1 UTSW 4 56812534 missense probably benign 0.06
R1954:Ctnnal1 UTSW 4 56817242 splice site probably benign
R2050:Ctnnal1 UTSW 4 56835350 missense probably benign 0.38
R2104:Ctnnal1 UTSW 4 56812329 makesense probably null
R3104:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3106:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3918:Ctnnal1 UTSW 4 56865000 missense possibly damaging 0.89
R4705:Ctnnal1 UTSW 4 56812579 missense probably benign 0.09
R4757:Ctnnal1 UTSW 4 56847980 missense probably damaging 1.00
R4780:Ctnnal1 UTSW 4 56847857 missense probably damaging 1.00
R4988:Ctnnal1 UTSW 4 56847854 nonsense probably null
R5771:Ctnnal1 UTSW 4 56826328 missense probably benign 0.00
R5974:Ctnnal1 UTSW 4 56817067 missense probably damaging 1.00
R6061:Ctnnal1 UTSW 4 56812349 missense probably benign
R6129:Ctnnal1 UTSW 4 56829573 missense possibly damaging 0.93
R6389:Ctnnal1 UTSW 4 56813849 missense probably benign 0.00
R7259:Ctnnal1 UTSW 4 56817299 critical splice acceptor site probably null
R7372:Ctnnal1 UTSW 4 56826285 missense possibly damaging 0.75
R7454:Ctnnal1 UTSW 4 56844544 missense probably damaging 1.00
R7520:Ctnnal1 UTSW 4 56837838 missense probably damaging 1.00
R7547:Ctnnal1 UTSW 4 56817032 missense probably damaging 0.99
R7671:Ctnnal1 UTSW 4 56837848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTTTCAGACGAGCATGAAAC -3'
(R):5'- ATACGAGTCGTAGGCTAGGAGCAC -3'

Sequencing Primer
(F):5'- CATGGAAACAGACTCTGTGTG -3'
(R):5'- acactcaggagactaaaacagg -3'
Posted On2013-05-09