Incidental Mutation 'R0217:Sbno1'
ID33610
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Namestrawberry notch 1
Synonyms9330180L10Rik, sno
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0217 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location124368702-124426001 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 124404324 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000196329] [ENSMUST00000196644] [ENSMUST00000196711] [ENSMUST00000199004] [ENSMUST00000199808] [ENSMUST00000200474]
Predicted Effect probably null
Transcript: ENSMUST00000065263
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000065263
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168651
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196329
SMART Domains Protein: ENSMUSP00000143084
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Pfam:AAA_34 217 525 1.4e-139 PFAM
Pfam:ResIII 254 441 2.4e-8 PFAM
low complexity region 598 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196644
SMART Domains Protein: ENSMUSP00000142827
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 4.3e-136 PFAM
Pfam:ResIII 289 476 1.8e-6 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196711
SMART Domains Protein: ENSMUSP00000142980
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199004
SMART Domains Protein: ENSMUSP00000143314
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199808
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200474
SMART Domains Protein: ENSMUSP00000143516
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 181 198 N/A INTRINSIC
Pfam:AAA_34 218 523 2.3e-141 PFAM
Pfam:ResIII 251 442 3.3e-7 PFAM
low complexity region 597 613 N/A INTRINSIC
low complexity region 691 712 N/A INTRINSIC
low complexity region 743 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200674
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124402205 missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124410249 missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124381706 missense probably benign 0.41
IGL01330:Sbno1 APN 5 124391979 missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124378555 splice site probably benign
IGL01800:Sbno1 APN 5 124381505 splice site probably benign
IGL01987:Sbno1 APN 5 124404219 missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124400195 splice site probably null
IGL02544:Sbno1 APN 5 124403983 missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124381677 splice site probably benign
IGL02592:Sbno1 APN 5 124400809 missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124376150 missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124387311 splice site probably benign
IGL03131:Sbno1 APN 5 124388605 missense probably damaging 1.00
Decrement UTSW 5 124400847 missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124386868 missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124410285 missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124410139 missense probably damaging 1.00
R0653:Sbno1 UTSW 5 124386892 missense possibly damaging 0.79
R0655:Sbno1 UTSW 5 124376149 missense possibly damaging 0.95
R1037:Sbno1 UTSW 5 124393912 missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124384460 splice site probably benign
R1522:Sbno1 UTSW 5 124392612 missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124384504 missense possibly damaging 0.55
R1618:Sbno1 UTSW 5 124404216 missense probably damaging 1.00
R1671:Sbno1 UTSW 5 124392067 splice site probably null
R1779:Sbno1 UTSW 5 124388517 unclassified probably benign
R2103:Sbno1 UTSW 5 124393937 missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124387534 synonymous probably null
R2149:Sbno1 UTSW 5 124402119 synonymous probably null
R2153:Sbno1 UTSW 5 124378543 missense probably benign
R2154:Sbno1 UTSW 5 124378511 missense probably benign
R2231:Sbno1 UTSW 5 124405704 missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R3004:Sbno1 UTSW 5 124381708 missense probably damaging 0.96
R3922:Sbno1 UTSW 5 124381930 missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R4096:Sbno1 UTSW 5 124391920 critical splice donor site probably null
R4612:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124374609 missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124400165 missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124408475 critical splice donor site probably null
R5365:Sbno1 UTSW 5 124381866 frame shift probably null
R5399:Sbno1 UTSW 5 124392741 missense probably benign 0.09
R5704:Sbno1 UTSW 5 124395893 critical splice donor site probably null
R5898:Sbno1 UTSW 5 124386791 intron probably benign
R6136:Sbno1 UTSW 5 124378491 missense probably benign 0.41
R6154:Sbno1 UTSW 5 124378479 missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124392714 missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124395931 missense probably benign 0.28
R6454:Sbno1 UTSW 5 124400847 missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124381720 missense possibly damaging 0.83
R7176:Sbno1 UTSW 5 124392881 missense probably benign 0.21
R7219:Sbno1 UTSW 5 124405659 missense probably benign 0.00
R7535:Sbno1 UTSW 5 124413279 missense possibly damaging 0.48
R7673:Sbno1 UTSW 5 124413216 missense probably benign
R7692:Sbno1 UTSW 5 124405646 missense probably benign 0.35
R7745:Sbno1 UTSW 5 124392899 missense probably benign 0.00
R7762:Sbno1 UTSW 5 124374666 missense probably benign 0.19
Z1088:Sbno1 UTSW 5 124393958 missense possibly damaging 0.91
Z1088:Sbno1 UTSW 5 124404304 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCCTGATAAGCTCATCAGTCAGCC -3'
(R):5'- GCTAACTGTCCCCATGATTTACGTACC -3'

Sequencing Primer
(F):5'- CATGGAACTTACCACAATGCTC -3'
(R):5'- TTACGTACCACATGGAAGTTGG -3'
Posted On2013-05-09