Mutagenetix > Incidental Mutations

Incidental Mutation 'R0217:Polr1a'

33612

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

038466-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0217 (G1)

Quality Score

211

Status

Validated (trace)

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71963703 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1007 (V1007A)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296]

Predicted Effect

probably benign
Transcript: ENSMUST00000055296
AA Change: V1007A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: V1007A

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181028

Predicted Effect

unknown
Transcript: ENSMUST00000205517
AA Change: V32A

Meta Mutation Damage Score

0.2304

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr3	A	G	1: 125,407,413		probably benign	Het
Adamts13	A	G	2: 26,996,921		probably benign	Het
Afap1l1	A	G	18: 61,746,869	V310A	probably damaging	Het
Alms1	T	A	6: 85,622,930	S2048R	probably damaging	Het
Aspm	T	A	1: 139,457,880	S421T	possibly damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc150	T	G	1: 54,300,430	S478A	possibly damaging	Het
Ccnyl1	T	A	1: 64,713,098		probably benign	Het
Cdc23	T	C	18: 34,651,665	T15A	unknown	Het
Cdk19	C	T	10: 40,476,258		probably benign	Het
Comp	A	C	8: 70,378,908	D420A	probably damaging	Het
Ctnnal1	T	C	4: 56,813,230	H667R	probably benign	Het
Cyp20a1	C	A	1: 60,343,466		probably benign	Het
Eci3	A	C	13: 34,948,089	S259A	probably benign	Het
Fcnb	T	C	2: 28,079,677	D126G	probably benign	Het
Foxk1	T	C	5: 142,401,894	M124T	possibly damaging	Het
Gm12790	T	C	4: 101,968,034	Y61C	probably damaging	Het
Gm498	T	C	7: 143,894,219		probably benign	Het
Hmgcr	A	C	13: 96,651,980	I777S	probably damaging	Het
Hsdl2	A	G	4: 59,597,311	E100G	probably damaging	Het
Itgb2	G	T	10: 77,548,536		probably benign	Het
Jak2	T	A	19: 29,296,650		probably null	Het
Lrba	T	C	3: 86,642,722	S2333P	probably damaging	Het
Man1a2	A	G	3: 100,617,037	L365P	possibly damaging	Het
Map2k5	A	T	9: 63,256,975		probably null	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Megf8	T	A	7: 25,364,079	L2620Q	probably damaging	Het
Nf1	A	T	11: 79,428,574		probably benign	Het
Olfr390	T	A	11: 73,787,388	V150E	possibly damaging	Het
Olfr491	C	A	7: 108,317,298	H135N	probably benign	Het
Olfr746	A	G	14: 50,654,095	N286S	probably damaging	Het
Pank3	T	A	11: 35,777,728	D181E	probably benign	Het
Pip5k1a	A	G	3: 95,073,991		probably null	Het
Plag1	A	C	4: 3,904,379	S271A	probably benign	Het
Plxna2	T	A	1: 194,644,598	I280N	probably damaging	Het
Ppm1h	T	A	10: 122,920,735	D428E	probably damaging	Het
Prelid2	A	T	18: 41,935,252		probably benign	Het
Ptk2b	T	C	14: 66,156,381	Y881C	probably damaging	Het
Rptor	T	C	11: 119,894,912		probably benign	Het
Sbno1	T	C	5: 124,404,324		probably null	Het
Scaf4	T	C	16: 90,242,682	D843G	probably damaging	Het
Serpina3b	C	T	12: 104,130,727	A89V	probably damaging	Het
Serpinb9d	C	A	13: 33,198,022	T158N	possibly damaging	Het
Slc39a10	C	T	1: 46,835,540	V201I	probably benign	Het
Slc6a13	T	A	6: 121,324,320	N189K	probably damaging	Het
Smco1	G	T	16: 32,273,781	R90L	possibly damaging	Het
Stim1	T	A	7: 102,435,800	M653K	probably benign	Het
Stxbp1	T	C	2: 32,801,870	S437G	possibly damaging	Het
Stxbp3-ps	T	G	19: 9,559,132		noncoding transcript	Het
Tgtp1	A	C	11: 48,987,319	S186R	probably benign	Het
Trpc7	C	T	13: 56,789,768	W570*	probably null	Het
Trpv4	C	A	5: 114,634,661	R289L	possibly damaging	Het
Vmn2r82	A	G	10: 79,378,800	M206V	possibly damaging	Het
Wdr47	T	A	3: 108,637,020	V653E	probably damaging	Het
Zfp113	T	C	5: 138,150,691	R64G	probably benign	Het
Zfp661	C	T	2: 127,577,291	E310K	probably damaging	Het
Zfp735	T	A	11: 73,711,286	I352N	possibly damaging	Het
Zswim4	A	G	8: 84,212,664	L863P	probably damaging	Het
Zzef1	T	A	11: 72,889,068	I1889N	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	intron	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R7918:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGCAGGAATTGTAGCCTCTGGATG -3'
(R):5'- AGTTTAAGGCCCAGTACTCCCACTC -3'

Sequencing Primer
(F):5'- AGCCTCTGGATGTTAGAGCC -3'
(R):5'- AGATACTCATGTGTTGCCATGACC -3'

Posted On

2013-05-09