Incidental Mutation 'R0217:Gm498'
ID33618
Institutional Source Beutler Lab
Gene Symbol Gm498
Ensembl Gene ENSMUSG00000031085
Gene Namepredicted gene 498
SynonymsLOC244239
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0217 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location143866838-143900046 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 143894219 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134455] [ENSMUST00000152910] [ENSMUST00000179036] [ENSMUST00000207235] [ENSMUST00000207482] [ENSMUST00000207630] [ENSMUST00000207642] [ENSMUST00000208038] [ENSMUST00000208153] [ENSMUST00000208457] [ENSMUST00000208625] [ENSMUST00000208761]
Predicted Effect probably benign
Transcript: ENSMUST00000134455
Predicted Effect probably benign
Transcript: ENSMUST00000152910
SMART Domains Protein: ENSMUSP00000115809
Gene: ENSMUSG00000031085

DomainStartEndE-ValueType
ACTIN 3 372 1.94e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179036
SMART Domains Protein: ENSMUSP00000137404
Gene: ENSMUSG00000031085

DomainStartEndE-ValueType
ACTIN 5 330 1.4e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207388
Predicted Effect probably benign
Transcript: ENSMUST00000207482
Predicted Effect probably benign
Transcript: ENSMUST00000207630
Predicted Effect probably benign
Transcript: ENSMUST00000207642
Predicted Effect probably benign
Transcript: ENSMUST00000208038
Predicted Effect probably benign
Transcript: ENSMUST00000208153
Predicted Effect probably benign
Transcript: ENSMUST00000208457
Predicted Effect probably benign
Transcript: ENSMUST00000208625
Predicted Effect probably benign
Transcript: ENSMUST00000208761
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Gm498
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02202:Gm498 APN 7 143894173 missense possibly damaging 0.71
R0128:Gm498 UTSW 7 143891755 missense probably damaging 1.00
R0726:Gm498 UTSW 7 143871761 missense probably damaging 0.99
R1025:Gm498 UTSW 7 143896390 missense probably damaging 0.99
R2879:Gm498 UTSW 7 143894063 nonsense probably null
R2925:Gm498 UTSW 7 143883999 nonsense probably null
R3625:Gm498 UTSW 7 143871854 missense possibly damaging 0.71
R4003:Gm498 UTSW 7 143897303 missense probably benign 0.16
R4184:Gm498 UTSW 7 143894121 nonsense probably null
R4205:Gm498 UTSW 7 143869227 missense probably damaging 0.99
R6179:Gm498 UTSW 7 143871787 missense probably benign 0.12
R7170:Gm498 UTSW 7 143896365 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCGAGTACATCCGAGACCTGAAAGAC -3'
(R):5'- TGCTATGGAAGCAAGTGCTGGG -3'

Sequencing Primer
(F):5'- CCTGAAAGACAAATACAGCTATGTG -3'
(R):5'- TGCAGTTGGACTAAGACTTCTG -3'
Posted On2013-05-09