Incidental Mutation 'R0217:Cdk19'
ID33622
Institutional Source Beutler Lab
Gene Symbol Cdk19
Ensembl Gene ENSMUSG00000038481
Gene Namecyclin-dependent kinase 19
SynonymsCdc2l6, 2700084L06Rik
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0217 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location40339564-40483818 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 40476258 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044672] [ENSMUST00000095743] [ENSMUST00000214659] [ENSMUST00000215000]
Predicted Effect probably benign
Transcript: ENSMUST00000044672
SMART Domains Protein: ENSMUSP00000040936
Gene: ENSMUSG00000038481

DomainStartEndE-ValueType
S_TKc 21 335 9.96e-83 SMART
low complexity region 371 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 467 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095743
SMART Domains Protein: ENSMUSP00000093414
Gene: ENSMUSG00000038481

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 22 172 7.2e-17 PFAM
Pfam:Pkinase 23 166 2.5e-29 PFAM
Pfam:Pkinase 164 291 1.2e-11 PFAM
low complexity region 327 361 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 423 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214659
Predicted Effect probably benign
Transcript: ENSMUST00000215000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216736
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of the components of the Mediator co-activator complex. The Mediator complex is a multi-protein complex required for transcriptional activation by DNA binding transcription factors of genes transcribed by RNA polymerase II. The protein encoded by this gene is similar to cyclin-dependent kinase 8 which can also be a component of the Mediator complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Cdk19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Cdk19 APN 10 40436165 missense probably benign 0.14
IGL00482:Cdk19 APN 10 40469648 missense possibly damaging 0.61
IGL03380:Cdk19 APN 10 40476912 missense probably benign 0.42
R1639:Cdk19 UTSW 10 40476969 critical splice donor site probably null
R1899:Cdk19 UTSW 10 40479780 utr 3 prime probably benign
R2102:Cdk19 UTSW 10 40479730 utr 3 prime probably benign
R3828:Cdk19 UTSW 10 40475613 missense probably damaging 0.96
R4124:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4125:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4128:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4474:Cdk19 UTSW 10 40469956 critical splice donor site probably null
R4668:Cdk19 UTSW 10 40466710 missense probably damaging 0.98
R4750:Cdk19 UTSW 10 40476199 missense probably damaging 1.00
R4871:Cdk19 UTSW 10 40476236 missense probably benign 0.03
R4993:Cdk19 UTSW 10 40476218 missense possibly damaging 0.79
R5078:Cdk19 UTSW 10 40436154 missense probably damaging 1.00
R7130:Cdk19 UTSW 10 40479765 missense unknown
R7570:Cdk19 UTSW 10 40477958 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCAAAGTGTTCCTCCTGGTAGGTG -3'
(R):5'- CTATGAATCTGGCATGGCCTCTCTG -3'

Sequencing Primer
(F):5'- gccttgacaatccacaatcc -3'
(R):5'- ACGAGTCAGGCAAATGCT -3'
Posted On2013-05-09