Incidental Mutation 'R0217:Vmn2r82'
ID33624
Institutional Source Beutler Lab
Gene Symbol Vmn2r82
Ensembl Gene ENSMUSG00000091468
Gene Namevomeronasal 2, receptor 82
SynonymsEG624845
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0217 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location79356576-79397198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79378800 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 206 (M206V)
Ref Sequence ENSEMBL: ENSMUSP00000130114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170596]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170596
AA Change: M206V

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: M206V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 6e-35 PFAM
Pfam:NCD3G 517 570 9.3e-22 PFAM
Pfam:7tm_3 603 838 6.5e-49 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Vmn2r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Vmn2r82 APN 10 79356747 missense probably benign 0.03
IGL01860:Vmn2r82 APN 10 79378857 missense probably benign 0.18
IGL01927:Vmn2r82 APN 10 79378072 missense probably damaging 1.00
IGL01929:Vmn2r82 APN 10 79378711 missense probably damaging 1.00
IGL02028:Vmn2r82 APN 10 79379223 missense probably benign
IGL02112:Vmn2r82 APN 10 79395999 missense probably benign 0.19
IGL02632:Vmn2r82 APN 10 79356708 missense probably benign 0.45
IGL02665:Vmn2r82 APN 10 79379371 missense probably damaging 0.99
IGL02716:Vmn2r82 APN 10 79377844 missense probably benign 0.20
IGL03030:Vmn2r82 APN 10 79381315 missense possibly damaging 0.85
IGL03190:Vmn2r82 APN 10 79356809 splice site probably null
IGL03349:Vmn2r82 APN 10 79377869 missense probably benign 0.25
IGL03048:Vmn2r82 UTSW 10 79396626 missense probably damaging 0.98
R0080:Vmn2r82 UTSW 10 79396505 missense probably benign 0.00
R0193:Vmn2r82 UTSW 10 79381295 missense probably damaging 1.00
R0285:Vmn2r82 UTSW 10 79396557 missense probably damaging 1.00
R1193:Vmn2r82 UTSW 10 79377905 nonsense probably null
R1385:Vmn2r82 UTSW 10 79396491 nonsense probably null
R1386:Vmn2r82 UTSW 10 79378711 missense probably damaging 1.00
R1442:Vmn2r82 UTSW 10 79379367 missense probably benign 0.03
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1518:Vmn2r82 UTSW 10 79378868 missense probably damaging 1.00
R1538:Vmn2r82 UTSW 10 79356744 missense possibly damaging 0.92
R1607:Vmn2r82 UTSW 10 79379419 missense possibly damaging 0.67
R1812:Vmn2r82 UTSW 10 79379212 missense probably benign 0.33
R1906:Vmn2r82 UTSW 10 79396510 missense probably damaging 1.00
R1954:Vmn2r82 UTSW 10 79396056 missense probably damaging 1.00
R1972:Vmn2r82 UTSW 10 79378846 missense probably damaging 1.00
R2093:Vmn2r82 UTSW 10 79395979 missense probably benign 0.30
R2156:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R2202:Vmn2r82 UTSW 10 79356685 missense probably benign
R2442:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R2444:Vmn2r82 UTSW 10 79377868 missense possibly damaging 0.65
R2857:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2858:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2884:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R2886:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R4369:Vmn2r82 UTSW 10 79396080 missense probably benign 0.01
R4445:Vmn2r82 UTSW 10 79379040 missense possibly damaging 0.87
R4589:Vmn2r82 UTSW 10 79356714 missense probably damaging 1.00
R4703:Vmn2r82 UTSW 10 79378807 missense probably damaging 1.00
R4908:Vmn2r82 UTSW 10 79378755 missense probably benign 0.00
R4937:Vmn2r82 UTSW 10 79379176 missense probably benign 0.01
R5199:Vmn2r82 UTSW 10 79396087 missense probably damaging 1.00
R5391:Vmn2r82 UTSW 10 79356657 missense probably null 0.01
R5601:Vmn2r82 UTSW 10 79396191 missense probably damaging 1.00
R5635:Vmn2r82 UTSW 10 79378818 missense probably benign 0.33
R6065:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R6074:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R6340:Vmn2r82 UTSW 10 79395893 missense probably benign 0.00
R6474:Vmn2r82 UTSW 10 79379037 missense possibly damaging 0.55
R6995:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R7111:Vmn2r82 UTSW 10 79378771 missense probably benign 0.22
R7212:Vmn2r82 UTSW 10 79379434 missense probably benign 0.00
R7335:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R7353:Vmn2r82 UTSW 10 79396618 missense probably benign 0.11
R7354:Vmn2r82 UTSW 10 79356630 missense probably benign 0.00
R7362:Vmn2r82 UTSW 10 79396617 missense probably benign 0.00
R7378:Vmn2r82 UTSW 10 79396442 nonsense probably null
R7430:Vmn2r82 UTSW 10 79381253 missense probably damaging 1.00
R7509:Vmn2r82 UTSW 10 79396008 missense possibly damaging 0.82
R7874:Vmn2r82 UTSW 10 79396511 missense probably damaging 1.00
R7957:Vmn2r82 UTSW 10 79396511 missense probably damaging 1.00
Z1088:Vmn2r82 UTSW 10 79356622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGTGAGTGATGAGCAGCCAGA -3'
(R):5'- TGTGATAGCAAACGAAGTAGGGTTTCC -3'

Sequencing Primer
(F):5'- tggagttatcacagagaaaggag -3'
(R):5'- GGGTTTCCCCCAGATATAATACTG -3'
Posted On2013-05-09