Incidental Mutation 'R0217:Trpc7'
ID33634
Institutional Source Beutler Lab
Gene Symbol Trpc7
Ensembl Gene ENSMUSG00000021541
Gene Nametransient receptor potential cation channel, subfamily C, member 7
SynonymsTrrp8, TRP7
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R0217 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location56773113-56895993 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 56789768 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 570 (W570*)
Ref Sequence ENSEMBL: ENSMUSP00000133305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022023] [ENSMUST00000109871] [ENSMUST00000151918] [ENSMUST00000173817] [ENSMUST00000174457]
Predicted Effect probably null
Transcript: ENSMUST00000022023
AA Change: W625*
SMART Domains Protein: ENSMUSP00000022023
Gene: ENSMUSG00000021541
AA Change: W625*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 6e-28 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Pfam:Ion_trans 387 684 2.4e-34 PFAM
Pfam:PKD_channel 427 679 5.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109871
AA Change: W625*
SMART Domains Protein: ENSMUSP00000105497
Gene: ENSMUSG00000021541
AA Change: W625*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 1.1e-31 PFAM
transmembrane domain 352 374 N/A INTRINSIC
transmembrane domain 389 406 N/A INTRINSIC
Pfam:PKD_channel 427 679 1.6e-13 PFAM
Pfam:Ion_trans 441 672 7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151918
SMART Domains Protein: ENSMUSP00000119809
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 4.6e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173067
SMART Domains Protein: ENSMUSP00000134481
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 5.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173466
SMART Domains Protein: ENSMUSP00000134285
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 9.5e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173513
AA Change: W508*
SMART Domains Protein: ENSMUSP00000134662
Gene: ENSMUSG00000021541
AA Change: W508*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.5e-31 PFAM
Pfam:PKD_channel 311 563 2.6e-13 PFAM
Pfam:Ion_trans 325 556 1.1e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173817
AA Change: W564*
SMART Domains Protein: ENSMUSP00000133411
Gene: ENSMUSG00000021541
AA Change: W564*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
transmembrane domain 291 313 N/A INTRINSIC
transmembrane domain 328 345 N/A INTRINSIC
Pfam:PKD_channel 366 618 3.7e-13 PFAM
Pfam:Ion_trans 380 611 1.2e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174457
AA Change: W570*
SMART Domains Protein: ENSMUSP00000133305
Gene: ENSMUSG00000021541
AA Change: W570*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
Pfam:PKD_channel 372 624 3.8e-13 PFAM
Pfam:Ion_trans 386 617 1.3e-35 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the transient receptor potential channel family of proteins, which form six-transmembrane cation-permeable channels that are calcium permeant. Knock out mice are viable but display a reduction in the gamma wave activity that precedes seizure induction in response to a muscrarinic agonist, suggesting a functional role for this protein in initiation of seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Trpc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Trpc7 APN 13 56773809 missense possibly damaging 0.64
IGL00809:Trpc7 APN 13 56822488 missense probably benign 0.00
IGL01011:Trpc7 APN 13 56804540 missense probably damaging 1.00
IGL01517:Trpc7 APN 13 56861065 missense probably damaging 1.00
IGL01824:Trpc7 APN 13 56789722 nonsense probably null
IGL02055:Trpc7 APN 13 56887544 missense probably benign 0.13
IGL02267:Trpc7 APN 13 56860930 missense probably damaging 1.00
IGL02323:Trpc7 APN 13 56783751 missense possibly damaging 0.91
IGL02451:Trpc7 APN 13 56822461 missense probably damaging 0.98
IGL02635:Trpc7 APN 13 56776168 missense probably damaging 1.00
IGL03335:Trpc7 APN 13 56887691 missense probably damaging 1.00
PIT4305001:Trpc7 UTSW 13 56887508 missense probably benign 0.00
R0611:Trpc7 UTSW 13 56887823 missense probably damaging 1.00
R0919:Trpc7 UTSW 13 56822649 splice site probably benign
R1235:Trpc7 UTSW 13 56887539 missense probably damaging 1.00
R1751:Trpc7 UTSW 13 56776143 missense probably damaging 1.00
R4324:Trpc7 UTSW 13 56887356 missense probably damaging 0.99
R4649:Trpc7 UTSW 13 56887554 missense probably damaging 1.00
R4731:Trpc7 UTSW 13 56804553 missense probably damaging 1.00
R5379:Trpc7 UTSW 13 56804550 missense probably damaging 1.00
R5834:Trpc7 UTSW 13 56776158 missense probably damaging 1.00
R5985:Trpc7 UTSW 13 56810545 missense probably damaging 0.96
R6244:Trpc7 UTSW 13 56773892 missense probably damaging 1.00
R6599:Trpc7 UTSW 13 56810380 splice site probably null
R6778:Trpc7 UTSW 13 56804687 missense probably damaging 1.00
R7140:Trpc7 UTSW 13 56789674 nonsense probably null
R7150:Trpc7 UTSW 13 56783696 missense probably benign 0.00
R7156:Trpc7 UTSW 13 56789766 missense possibly damaging 0.61
R7238:Trpc7 UTSW 13 56826897 missense probably benign 0.17
R7716:Trpc7 UTSW 13 56789760 missense probably damaging 1.00
R7739:Trpc7 UTSW 13 56773766 makesense probably null
Z1177:Trpc7 UTSW 13 56810444 missense not run
Z1177:Trpc7 UTSW 13 56822432 missense not run
Predicted Primers PCR Primer
(F):5'- ATGGCAGAAAACGTGCTCCAGG -3'
(R):5'- ATTTCAGAGTGTAGGCAGTCGCAG -3'

Sequencing Primer
(F):5'- CTCCAGGGAGAATGTCTGTTAC -3'
(R):5'- GAGAGGGCAGCTTTCATGTT -3'
Posted On2013-05-09