Incidental Mutation 'R0217:Olfr746'
ID33636
Institutional Source Beutler Lab
Gene Symbol Olfr746
Ensembl Gene ENSMUSG00000058188
Gene Nameolfactory receptor 746
SynonymsGA_x6K02T2PMLR-6372116-6373060, MOR106-12
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0217 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location50647083-50654183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50654095 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 286 (N286S)
Ref Sequence ENSEMBL: ENSMUSP00000151399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080616] [ENSMUST00000218546]
Predicted Effect probably damaging
Transcript: ENSMUST00000080616
AA Change: N286S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079451
Gene: ENSMUSG00000058188
AA Change: N286S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.9e-52 PFAM
Pfam:7tm_1 41 290 2.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218546
AA Change: N286S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Jak2 T A 19: 29,296,650 probably null Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Olfr746
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03288:Olfr746 APN 14 50653375 missense possibly damaging 0.78
IGL03333:Olfr746 APN 14 50653398 nonsense probably null
R0621:Olfr746 UTSW 14 50653962 missense possibly damaging 0.91
R1656:Olfr746 UTSW 14 50654008 missense probably benign 0.16
R1975:Olfr746 UTSW 14 50653364 missense probably damaging 1.00
R4281:Olfr746 UTSW 14 50653572 missense probably benign 0.18
R5763:Olfr746 UTSW 14 50654068 missense possibly damaging 0.84
R6236:Olfr746 UTSW 14 50653800 missense probably damaging 1.00
R6612:Olfr746 UTSW 14 50653633 missense probably damaging 1.00
R7112:Olfr746 UTSW 14 50654126 missense probably benign 0.03
R7125:Olfr746 UTSW 14 50653584 missense possibly damaging 0.92
R7221:Olfr746 UTSW 14 50654071 missense probably damaging 0.99
R7810:Olfr746 UTSW 14 50653993 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGGACCCACTAATAGCACTGTCCTG -3'
(R):5'- ATCTGTGAAGGTGCCCTTGGAAGC -3'

Sequencing Primer
(F):5'- AGCTCAGAGCTGTTCTTCAG -3'
(R):5'- TGGAAGCATTGAGTGTCCCATAG -3'
Posted On2013-05-09