Incidental Mutation 'R0217:Jak2'
ID33645
Institutional Source Beutler Lab
Gene Symbol Jak2
Ensembl Gene ENSMUSG00000024789
Gene NameJanus kinase 2
SynonymsC81284
MMRRC Submission 038466-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0217 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location29251828-29313080 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 29296650 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025705] [ENSMUST00000065796]
Predicted Effect probably null
Transcript: ENSMUST00000025705
SMART Domains Protein: ENSMUSP00000025705
Gene: ENSMUSG00000024789

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065796
SMART Domains Protein: ENSMUSP00000064394
Gene: ENSMUSG00000024789

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations die during midgestation due to a failure of erythropoieses. Mice expressing a conditional allele activated in mammary tissue exhibit lactation deficiency due to impaired alveologenesis. Mice homozygous for a knock-in allele exhibit myeloproliferative neoplasm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 A G 1: 125,407,413 probably benign Het
Adamts13 A G 2: 26,996,921 probably benign Het
Afap1l1 A G 18: 61,746,869 V310A probably damaging Het
Alms1 T A 6: 85,622,930 S2048R probably damaging Het
Aspm T A 1: 139,457,880 S421T possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc150 T G 1: 54,300,430 S478A possibly damaging Het
Ccnyl1 T A 1: 64,713,098 probably benign Het
Cdc23 T C 18: 34,651,665 T15A unknown Het
Cdk19 C T 10: 40,476,258 probably benign Het
Comp A C 8: 70,378,908 D420A probably damaging Het
Ctnnal1 T C 4: 56,813,230 H667R probably benign Het
Cyp20a1 C A 1: 60,343,466 probably benign Het
Eci3 A C 13: 34,948,089 S259A probably benign Het
Fcnb T C 2: 28,079,677 D126G probably benign Het
Foxk1 T C 5: 142,401,894 M124T possibly damaging Het
Gm12790 T C 4: 101,968,034 Y61C probably damaging Het
Gm498 T C 7: 143,894,219 probably benign Het
Hmgcr A C 13: 96,651,980 I777S probably damaging Het
Hsdl2 A G 4: 59,597,311 E100G probably damaging Het
Itgb2 G T 10: 77,548,536 probably benign Het
Lrba T C 3: 86,642,722 S2333P probably damaging Het
Man1a2 A G 3: 100,617,037 L365P possibly damaging Het
Map2k5 A T 9: 63,256,975 probably null Het
Mcc C G 18: 44,519,516 probably benign Het
Megf8 T A 7: 25,364,079 L2620Q probably damaging Het
Nf1 A T 11: 79,428,574 probably benign Het
Olfr390 T A 11: 73,787,388 V150E possibly damaging Het
Olfr491 C A 7: 108,317,298 H135N probably benign Het
Olfr746 A G 14: 50,654,095 N286S probably damaging Het
Pank3 T A 11: 35,777,728 D181E probably benign Het
Pip5k1a A G 3: 95,073,991 probably null Het
Plag1 A C 4: 3,904,379 S271A probably benign Het
Plxna2 T A 1: 194,644,598 I280N probably damaging Het
Polr1a T C 6: 71,963,703 V1007A probably benign Het
Ppm1h T A 10: 122,920,735 D428E probably damaging Het
Prelid2 A T 18: 41,935,252 probably benign Het
Ptk2b T C 14: 66,156,381 Y881C probably damaging Het
Rptor T C 11: 119,894,912 probably benign Het
Sbno1 T C 5: 124,404,324 probably null Het
Scaf4 T C 16: 90,242,682 D843G probably damaging Het
Serpina3b C T 12: 104,130,727 A89V probably damaging Het
Serpinb9d C A 13: 33,198,022 T158N possibly damaging Het
Slc39a10 C T 1: 46,835,540 V201I probably benign Het
Slc6a13 T A 6: 121,324,320 N189K probably damaging Het
Smco1 G T 16: 32,273,781 R90L possibly damaging Het
Stim1 T A 7: 102,435,800 M653K probably benign Het
Stxbp1 T C 2: 32,801,870 S437G possibly damaging Het
Stxbp3-ps T G 19: 9,559,132 noncoding transcript Het
Tgtp1 A C 11: 48,987,319 S186R probably benign Het
Trpc7 C T 13: 56,789,768 W570* probably null Het
Trpv4 C A 5: 114,634,661 R289L possibly damaging Het
Vmn2r82 A G 10: 79,378,800 M206V possibly damaging Het
Wdr47 T A 3: 108,637,020 V653E probably damaging Het
Zfp113 T C 5: 138,150,691 R64G probably benign Het
Zfp661 C T 2: 127,577,291 E310K probably damaging Het
Zfp735 T A 11: 73,711,286 I352N possibly damaging Het
Zswim4 A G 8: 84,212,664 L863P probably damaging Het
Zzef1 T A 11: 72,889,068 I1889N probably damaging Het
Other mutations in Jak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Jak2 APN 19 29301647 missense probably damaging 1.00
IGL00951:Jak2 APN 19 29299583 missense probably damaging 1.00
IGL01300:Jak2 APN 19 29309683 missense probably damaging 1.00
IGL01800:Jak2 APN 19 29286293 splice site probably benign
IGL02035:Jak2 APN 19 29286408 missense probably benign 0.24
IGL02212:Jak2 APN 19 29287982 missense probably benign 0.01
IGL02447:Jak2 APN 19 29299614 missense probably damaging 1.00
R0001:Jak2 UTSW 19 29282387 missense probably benign 0.01
R0158:Jak2 UTSW 19 29311757 missense probably benign
R0308:Jak2 UTSW 19 29311757 missense probably benign 0.15
R0344:Jak2 UTSW 19 29283629 missense probably damaging 1.00
R0398:Jak2 UTSW 19 29282388 missense possibly damaging 0.95
R0408:Jak2 UTSW 19 29286317 missense probably benign 0.38
R0453:Jak2 UTSW 19 29311838 missense probably benign 0.01
R0853:Jak2 UTSW 19 29284926 nonsense probably null
R1180:Jak2 UTSW 19 29282499 missense probably damaging 1.00
R1794:Jak2 UTSW 19 29299557 missense probably benign 0.00
R2247:Jak2 UTSW 19 29283636 missense probably benign 0.01
R3908:Jak2 UTSW 19 29291273 missense probably damaging 1.00
R4705:Jak2 UTSW 19 29294915 missense possibly damaging 0.82
R4744:Jak2 UTSW 19 29262256 missense probably benign 0.02
R4814:Jak2 UTSW 19 29301977 missense probably damaging 1.00
R4903:Jak2 UTSW 19 29275036 missense probably benign 0.03
R5602:Jak2 UTSW 19 29298339 missense probably benign 0.01
R5713:Jak2 UTSW 19 29271393 missense probably damaging 0.96
R5740:Jak2 UTSW 19 29262424 missense possibly damaging 0.81
R5758:Jak2 UTSW 19 29309643 missense probably damaging 1.00
R5966:Jak2 UTSW 19 29283554 missense possibly damaging 0.94
R6285:Jak2 UTSW 19 29295659 missense probably benign 0.35
R6439:Jak2 UTSW 19 29309622 synonymous probably null
R6624:Jak2 UTSW 19 29282589 missense probably damaging 0.99
R6649:Jak2 UTSW 19 29288710 missense probably benign 0.00
R6653:Jak2 UTSW 19 29288710 missense probably benign 0.00
R7084:Jak2 UTSW 19 29286398 missense possibly damaging 0.78
R7180:Jak2 UTSW 19 29282411 missense probably benign 0.01
R7261:Jak2 UTSW 19 29310985 missense possibly damaging 0.82
R7488:Jak2 UTSW 19 29298383 missense probably damaging 0.99
R7537:Jak2 UTSW 19 29298637 missense probably benign 0.00
R7757:Jak2 UTSW 19 29283546 missense probably benign
R7777:Jak2 UTSW 19 29276868 missense probably benign 0.32
X0058:Jak2 UTSW 19 29295711 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACTGCCAGAGTGCCTTCCAGTTAT -3'
(R):5'- CCTCCTCCATACAGATAGATGCACAGAA -3'

Sequencing Primer
(F):5'- TGTCAGCTACCACCTAGAAGTG -3'
(R):5'- agccatctctccagccc -3'
Posted On2013-05-09