Incidental Mutation 'R0218:Tas2r104'
ID33655
Institutional Source Beutler Lab
Gene Symbol Tas2r104
Ensembl Gene ENSMUSG00000061977
Gene Nametaste receptor, type 2, member 104
SynonymsT2R04, mGR04, Tas2r4, mt2r45
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0218 (G1)
Quality Score183
Status Validated
Chromosome6
Chromosomal Location131684836-131685744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 131685092 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 218 (D218A)
Ref Sequence ENSEMBL: ENSMUSP00000072237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072404
AA Change: D218A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977
AA Change: D218A

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Meta Mutation Damage Score 0.7683 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Tas2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tas2r104 APN 6 131685567 missense probably damaging 1.00
IGL01390:Tas2r104 APN 6 131685485 missense probably benign 0.13
IGL02751:Tas2r104 APN 6 131685144 missense probably damaging 1.00
PIT4585001:Tas2r104 UTSW 6 131685558 missense possibly damaging 0.50
R0453:Tas2r104 UTSW 6 131685341 missense probably benign 0.00
R0472:Tas2r104 UTSW 6 131685471 missense probably benign 0.06
R0614:Tas2r104 UTSW 6 131685202 missense probably damaging 1.00
R1290:Tas2r104 UTSW 6 131684845 nonsense probably null
R1480:Tas2r104 UTSW 6 131685294 missense probably benign 0.17
R1698:Tas2r104 UTSW 6 131685584 missense probably damaging 1.00
R2050:Tas2r104 UTSW 6 131685120 missense probably damaging 1.00
R2229:Tas2r104 UTSW 6 131685132 missense probably damaging 1.00
R3824:Tas2r104 UTSW 6 131685039 missense possibly damaging 0.55
R3852:Tas2r104 UTSW 6 131684925 missense probably benign 0.09
R4283:Tas2r104 UTSW 6 131685411 missense probably damaging 1.00
R4583:Tas2r104 UTSW 6 131685435 missense probably benign 0.00
R4710:Tas2r104 UTSW 6 131685444 missense probably damaging 0.96
R4954:Tas2r104 UTSW 6 131685005 missense probably damaging 0.99
R5559:Tas2r104 UTSW 6 131685131 missense probably damaging 1.00
R5765:Tas2r104 UTSW 6 131685273 missense probably benign
R5843:Tas2r104 UTSW 6 131684975 missense probably damaging 0.99
R7304:Tas2r104 UTSW 6 131685042 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTGCCCTCATAGTGGCTTGCTTC -3'
(R):5'- AACACATCCTGGCTGATCCACCTG -3'

Sequencing Primer
(F):5'- AGCTCCCTGCTTGTTAGAATTAG -3'
(R):5'- GCTGATCCACCTGGAGAAG -3'
Posted On2013-05-09