Incidental Mutation 'R0218:Npas1'
ID33656
Institutional Source Beutler Lab
Gene Symbol Npas1
Ensembl Gene ENSMUSG00000001988
Gene Nameneuronal PAS domain protein 1
SynonymsbHLHe11, MOP5
MMRRC Submission 038467-MU
Accession Numbers

Genbank: NM_008718; MGI: 109205

Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R0218 (G1)
Quality Score219
Status Validated
Chromosome7
Chromosomal Location16455721-16477728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16461893 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 285 (V285I)
Ref Sequence ENSEMBL: ENSMUSP00000147412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002053] [ENSMUST00000210748]
Predicted Effect probably benign
Transcript: ENSMUST00000002053
AA Change: V285I

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002053
Gene: ENSMUSG00000001988
AA Change: V285I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
HLH 51 106 1.44e-6 SMART
low complexity region 109 128 N/A INTRINSIC
PAS 137 203 1.09e-11 SMART
low complexity region 212 223 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
PAS 294 360 5.32e-6 SMART
PAC 366 409 5.64e0 SMART
low complexity region 428 443 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210748
AA Change: V285I

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211103
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. Studies of a related mouse gene suggest that it functions in neurons. The exact function of this gene is unclear, but it may play protective or modulatory roles during late embryogenesis and postnatal development. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Npas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Npas1 APN 7 16463322 missense probably benign 0.05
IGL01627:Npas1 APN 7 16465186 missense probably damaging 1.00
IGL02812:Npas1 APN 7 16456116 missense probably damaging 1.00
IGL03141:Npas1 APN 7 16465138 missense probably damaging 1.00
D4043:Npas1 UTSW 7 16463244 splice site probably null
H8786:Npas1 UTSW 7 16461350 missense possibly damaging 0.51
R1736:Npas1 UTSW 7 16474616 missense probably benign 0.24
R1795:Npas1 UTSW 7 16474800 missense probably damaging 1.00
R2093:Npas1 UTSW 7 16459277 missense probably benign
R2570:Npas1 UTSW 7 16474703 missense probably damaging 1.00
R4057:Npas1 UTSW 7 16474787 missense probably damaging 1.00
R4385:Npas1 UTSW 7 16459185 critical splice donor site probably null
R5937:Npas1 UTSW 7 16463262 missense probably benign 0.15
R6456:Npas1 UTSW 7 16461926 missense probably benign 0.44
R7195:Npas1 UTSW 7 16474808 missense probably damaging 1.00
R7544:Npas1 UTSW 7 16460974 intron probably null
Predicted Primers PCR Primer
(F):5'- CTGACTGAAAGGCCCAGGATTGAC -3'
(R):5'- TTTGTCCGCATGAAGTCCACCC -3'

Sequencing Primer
(F):5'- ACTGGTCCCCACATATCCC -3'
(R):5'- GCCTGAATGTCAAAGCCTCG -3'
Posted On2013-05-09