Incidental Mutation 'R0218:Mex3b'
ID33660
Institutional Source Beutler Lab
Gene Symbol Mex3b
Ensembl Gene ENSMUSG00000057706
Gene Namemex3 RNA binding family member B
Synonyms4931439A04Rik, Rkhd3
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R0218 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location82867333-82871515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82869104 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 209 (E209V)
Ref Sequence ENSEMBL: ENSMUSP00000082168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082237]
Predicted Effect probably damaging
Transcript: ENSMUST00000082237
AA Change: E209V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082168
Gene: ENSMUSG00000057706
AA Change: E209V

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 35 61 N/A INTRINSIC
KH 71 139 2.54e-9 SMART
KH 166 233 1.6e-15 SMART
low complexity region 262 270 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 389 424 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 494 515 N/A INTRINSIC
RING 525 564 3.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209046
Meta Mutation Damage Score 0.5350 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding phosphoprotein that is part of the MEX3 (muscle excess 3) family of translational regulators. The encoded protein contains N-terminal nuclear export and nuclear localization signals and is exported from the cytoplasm to the nucleus. The protein binds to RNA via two KH domains and also colocalizes with MEX3A, Dcp1A decapping factor and Argonaute proteins within P (processing) bodies. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous inactivation of this gene leads to partial neonatal lethality, decreased body weight and subfertility. Males show seminiferous tubule obstruction, oligozoospermia, abnormalities in Sertoli cell barrier morphology and function, and impaired Sertoli cell and macrophage phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Mex3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Mex3b APN 7 82868908 missense probably damaging 1.00
IGL01112:Mex3b APN 7 82869703 missense probably benign 0.41
IGL01490:Mex3b APN 7 82869827 missense possibly damaging 0.71
IGL01809:Mex3b APN 7 82869712 missense probably benign
IGL02328:Mex3b APN 7 82869712 missense probably benign
R0653:Mex3b UTSW 7 82869034 missense probably damaging 1.00
R2360:Mex3b UTSW 7 82867862 missense probably benign 0.16
R4184:Mex3b UTSW 7 82870030 missense probably benign 0.00
R4397:Mex3b UTSW 7 82869823 missense possibly damaging 0.88
R4771:Mex3b UTSW 7 82869065 missense possibly damaging 0.81
R4945:Mex3b UTSW 7 82870174 missense probably benign 0.03
R5189:Mex3b UTSW 7 82869251 missense probably damaging 0.96
R6962:Mex3b UTSW 7 82869265 missense probably benign 0.00
R7021:Mex3b UTSW 7 82869872 missense possibly damaging 0.49
R7381:Mex3b UTSW 7 82868865 missense possibly damaging 0.85
R7483:Mex3b UTSW 7 82867906 missense possibly damaging 0.89
RF009:Mex3b UTSW 7 82867760 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATCCGAGCCTCTCGTAACAAGAAC -3'
(R):5'- TCCCACCACCGAAGTAAGAGTCTG -3'

Sequencing Primer
(F):5'- GAACACGGCTCTCAACGG -3'
(R):5'- AAGCGAGCTGGAGCTGTC -3'
Posted On2013-05-09