Incidental Mutation 'R0218:Enpp3'
ID 33669
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission 038467-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R0218 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24652767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 730 (V730D)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
AlphaFold Q6DYE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000020169
AA Change: V730D

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: V730D

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219861
Meta Mutation Damage Score 0.1454 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l T G 8: 44,079,477 (GRCm39) Q249P probably benign Het
Adgrv1 C T 13: 81,255,017 (GRCm39) probably null Het
Ccdc110 A G 8: 46,387,761 (GRCm39) probably benign Het
Cd200r1 T A 16: 44,609,106 (GRCm39) probably benign Het
Cdkl1 A T 12: 69,836,809 (GRCm39) D40E probably benign Het
Cdx1 A G 18: 61,153,436 (GRCm39) probably benign Het
Cenpp T A 13: 49,801,108 (GRCm39) K103N possibly damaging Het
Cep162 A G 9: 87,093,862 (GRCm39) Y839H possibly damaging Het
Chac1 T A 2: 119,183,941 (GRCm39) L181* probably null Het
Ciapin1 G T 8: 95,554,938 (GRCm39) Q173K probably damaging Het
Cmklr2 T A 1: 63,222,690 (GRCm39) N182Y probably benign Het
Dgcr2 A G 16: 17,667,650 (GRCm39) C270R probably damaging Het
Dlc1 A G 8: 37,317,383 (GRCm39) S431P probably benign Het
Efcab12 T C 6: 115,791,611 (GRCm39) probably benign Het
Ehbp1 A T 11: 22,181,992 (GRCm39) probably benign Het
Fam174b A G 7: 73,390,512 (GRCm39) T88A probably benign Het
Fancl A G 11: 26,421,337 (GRCm39) K364E probably benign Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Galc A G 12: 98,188,906 (GRCm39) Y402H probably damaging Het
Gga2 T C 7: 121,598,123 (GRCm39) N324D possibly damaging Het
Hc G T 2: 34,918,086 (GRCm39) F732L probably damaging Het
Heca T C 10: 17,791,463 (GRCm39) M198V probably benign Het
Herc6 C A 6: 57,596,586 (GRCm39) H509N probably benign Het
Irf2bpl A T 12: 86,929,398 (GRCm39) M425K probably benign Het
Mael C T 1: 166,066,159 (GRCm39) G26D probably damaging Het
Map1a A G 2: 121,135,906 (GRCm39) T2241A probably benign Het
Mcc C G 18: 44,652,583 (GRCm39) probably benign Het
Mdga2 A G 12: 66,701,894 (GRCm39) S505P probably damaging Het
Mdm1 A G 10: 117,992,783 (GRCm39) probably benign Het
Mex3b A T 7: 82,518,312 (GRCm39) E209V probably damaging Het
Mrgprx3-ps T C 7: 46,959,154 (GRCm39) E279G possibly damaging Het
Ms4a20 A T 19: 11,093,801 (GRCm39) Y10* probably null Het
Nfe2l1 A T 11: 96,718,439 (GRCm39) L32Q probably damaging Het
Npas1 C T 7: 16,195,818 (GRCm39) V285I probably benign Het
Or5e1 T A 7: 108,354,781 (GRCm39) C239* probably null Het
Or5h19 C T 16: 58,856,456 (GRCm39) V215I probably benign Het
Or9i14 T C 19: 13,792,342 (GRCm39) N204S probably benign Het
Osr1 A G 12: 9,629,639 (GRCm39) T171A probably benign Het
Ppp3cb A T 14: 20,574,044 (GRCm39) C265S probably damaging Het
Pramel27 A G 4: 143,578,401 (GRCm39) I220M probably damaging Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Simc1 T C 13: 54,674,417 (GRCm39) Y922H probably damaging Het
Slc25a39 A G 11: 102,297,056 (GRCm39) F56L probably benign Het
Smg8 A G 11: 86,976,948 (GRCm39) L211P probably damaging Het
Sncaip A G 18: 53,040,400 (GRCm39) S805G probably benign Het
Sra1 T C 18: 36,809,662 (GRCm39) probably benign Het
Tas2r104 T G 6: 131,662,055 (GRCm39) D218A probably damaging Het
Unc45b A G 11: 82,802,686 (GRCm39) probably benign Het
Unc79 A G 12: 103,075,040 (GRCm39) probably null Het
Washc2 T A 6: 116,225,007 (GRCm39) L785* probably null Het
Zfp30 A G 7: 29,493,063 (GRCm39) E439G probably damaging Het
Zfp518a A G 19: 40,901,072 (GRCm39) T334A probably benign Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCAGACTCTACATTTCCTCCAGAA -3'
(R):5'- GGGCACAAACACTGTGGGTGTTA -3'

Sequencing Primer
(F):5'- GTGAGATTGCACAGTATCTAGTTC -3'
(R):5'- atcctcctgcctctgcc -3'
Posted On 2013-05-09