Incidental Mutation 'R0218:Mdm1'
ID33670
Institutional Source Beutler Lab
Gene Symbol Mdm1
Ensembl Gene ENSMUSG00000020212
Gene Nametransformed mouse 3T3 cell double minute 1
SynonymsArrd2, Mdm-1
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0218 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location118141811-118168997 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 118156878 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020437] [ENSMUST00000163238] [ENSMUST00000164077] [ENSMUST00000169817]
Predicted Effect probably benign
Transcript: ENSMUST00000020437
SMART Domains Protein: ENSMUSP00000020437
Gene: ENSMUSG00000020212

DomainStartEndE-ValueType
Pfam:MDM1 9 544 1.1e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163238
SMART Domains Protein: ENSMUSP00000127919
Gene: ENSMUSG00000020212

DomainStartEndE-ValueType
Pfam:MDM1 9 554 1.3e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164077
SMART Domains Protein: ENSMUSP00000132966
Gene: ENSMUSG00000020212

DomainStartEndE-ValueType
Pfam:MDM1 9 544 5.5e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169817
SMART Domains Protein: ENSMUSP00000126258
Gene: ENSMUSG00000020212

DomainStartEndE-ValueType
Pfam:MDM1 9 172 8.3e-55 PFAM
Pfam:MDM1 168 509 1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219605
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein similar to the mouse double minute 1 protein. The mouse gene is located in double minute (DM) chromatin particles, is amplified in the mouse transformed 3T3 cell line, and the encoded protein is able to bind to p53. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a nonsense point mutation exhibit retinal degeneration, abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Mdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Mdm1 APN 10 118164441 missense probably damaging 1.00
IGL01400:Mdm1 APN 10 118157251 missense probably damaging 1.00
IGL01504:Mdm1 APN 10 118146600 missense probably damaging 1.00
IGL02070:Mdm1 APN 10 118146618 missense probably damaging 1.00
IGL02149:Mdm1 APN 10 118148065 missense probably damaging 1.00
IGL02817:Mdm1 APN 10 118164346 missense possibly damaging 0.66
IGL03076:Mdm1 APN 10 118159683 missense possibly damaging 0.95
PIT4696001:Mdm1 UTSW 10 118158540 missense probably benign
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0166:Mdm1 UTSW 10 118166680 missense probably damaging 0.96
R0446:Mdm1 UTSW 10 118152056 missense probably benign 0.01
R0605:Mdm1 UTSW 10 118146601 missense probably damaging 1.00
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R2873:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R4816:Mdm1 UTSW 10 118146877 missense possibly damaging 0.82
R5571:Mdm1 UTSW 10 118159683 missense possibly damaging 0.95
R5623:Mdm1 UTSW 10 118150789 missense possibly damaging 0.66
R5806:Mdm1 UTSW 10 118166658 missense probably benign
R6537:Mdm1 UTSW 10 118158576 missense probably benign 0.00
R6539:Mdm1 UTSW 10 118150958 critical splice donor site probably null
R6891:Mdm1 UTSW 10 118148032 missense probably benign 0.04
R6952:Mdm1 UTSW 10 118168057 missense probably damaging 1.00
R7176:Mdm1 UTSW 10 118142865 missense probably damaging 1.00
R7346:Mdm1 UTSW 10 118164288 nonsense probably null
R7442:Mdm1 UTSW 10 118146685 missense probably benign 0.16
R7464:Mdm1 UTSW 10 118152266 missense probably benign 0.00
R8068:Mdm1 UTSW 10 118146804 missense possibly damaging 0.91
Z1088:Mdm1 UTSW 10 118158362 missense possibly damaging 0.67
Z1177:Mdm1 UTSW 10 118158496 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCAGTCAGTTACCTATCAGTAGCACC -3'
(R):5'- CAGGATACAGCCACAGTCCAATGAG -3'

Sequencing Primer
(F):5'- GGGATGACAATCAATTACCTATCAC -3'
(R):5'- CATCAGACTATGCGTTTCAGCAG -3'
Posted On2013-05-09