Incidental Mutation 'R0218:Smg8'
ID33673
Institutional Source Beutler Lab
Gene Symbol Smg8
Ensembl Gene ENSMUSG00000020495
Gene Namesmg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms1200011M11Rik
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R0218 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87077732-87086774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87086122 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 211 (L211P)
Ref Sequence ENSEMBL: ENSMUSP00000020801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020801] [ENSMUST00000051395] [ENSMUST00000143280]
Predicted Effect probably damaging
Transcript: ENSMUST00000020801
AA Change: L211P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020801
Gene: ENSMUSG00000020495
AA Change: L211P

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
Pfam:DUF2146 41 985 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051395
SMART Domains Protein: ENSMUSP00000060803
Gene: ENSMUSG00000020493

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
low complexity region 135 152 N/A INTRINSIC
low complexity region 184 212 N/A INTRINSIC
low complexity region 350 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143280
SMART Domains Protein: ENSMUSP00000119011
Gene: ENSMUSG00000020495

DomainStartEndE-ValueType
Pfam:DUF2146 1 269 2.9e-89 PFAM
Meta Mutation Damage Score 0.2181 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Smg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Smg8 APN 11 87078041 missense probably damaging 0.96
IGL01591:Smg8 APN 11 87085153 missense probably damaging 1.00
IGL01844:Smg8 APN 11 87080276 missense probably damaging 1.00
IGL02634:Smg8 APN 11 87086672 missense probably benign
IGL03170:Smg8 APN 11 87086608 missense probably damaging 1.00
IGL03206:Smg8 APN 11 87085988 unclassified probably null
R0378:Smg8 UTSW 11 87080423 missense probably damaging 1.00
R0497:Smg8 UTSW 11 87086084 missense possibly damaging 0.95
R0522:Smg8 UTSW 11 87086462 missense probably benign
R0546:Smg8 UTSW 11 87083613 missense possibly damaging 0.69
R0634:Smg8 UTSW 11 87086108 missense possibly damaging 0.86
R1245:Smg8 UTSW 11 87083610 missense possibly damaging 0.91
R1710:Smg8 UTSW 11 87086287 missense probably damaging 0.98
R1726:Smg8 UTSW 11 87080613 nonsense probably null
R1747:Smg8 UTSW 11 87085303 missense possibly damaging 0.93
R1748:Smg8 UTSW 11 87085768 missense probably damaging 1.00
R1909:Smg8 UTSW 11 87080613 nonsense probably null
R1981:Smg8 UTSW 11 87085331 missense probably benign 0.00
R2356:Smg8 UTSW 11 87085728 missense probably benign 0.00
R4459:Smg8 UTSW 11 87085570 missense probably benign 0.09
R4724:Smg8 UTSW 11 87086221 missense probably benign 0.39
R4914:Smg8 UTSW 11 87080710 missense probably damaging 1.00
R5023:Smg8 UTSW 11 87086137 missense probably damaging 1.00
R5284:Smg8 UTSW 11 87080311 missense possibly damaging 0.94
R5368:Smg8 UTSW 11 87080260 missense probably benign 0.21
R5534:Smg8 UTSW 11 87085470 missense probably benign 0.06
R5689:Smg8 UTSW 11 87085123 missense probably damaging 0.98
R6651:Smg8 UTSW 11 87086546 missense probably benign 0.30
R6896:Smg8 UTSW 11 87077961 missense possibly damaging 0.46
R7030:Smg8 UTSW 11 87085093 missense probably damaging 1.00
R7317:Smg8 UTSW 11 87085565 missense possibly damaging 0.76
X0028:Smg8 UTSW 11 87086122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTTTCACGGTACAATGGCTCC -3'
(R):5'- ACTCACAGCTTCTGCGTGCTTG -3'

Sequencing Primer
(F):5'- TACAATGGCTCCTAAGCTGG -3'
(R):5'- TCTGCGTGCTTGTCGGG -3'
Posted On2013-05-09