Incidental Mutation 'R0218:Nfe2l1'
ID33674
Institutional Source Beutler Lab
Gene Symbol Nfe2l1
Ensembl Gene ENSMUSG00000038615
Gene Namenuclear factor, erythroid derived 2,-like 1
SynonymsLCR-F1, TCF11, NRF1, TCF-11, Lcrf1
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0218 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96817414-96829968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96827613 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 32 (L32Q)
Ref Sequence ENSEMBL: ENSMUSP00000128527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081775] [ENSMUST00000107657] [ENSMUST00000107658] [ENSMUST00000107659] [ENSMUST00000126949] [ENSMUST00000142065] [ENSMUST00000167110] [ENSMUST00000167149] [ENSMUST00000169828]
Predicted Effect probably damaging
Transcript: ENSMUST00000081775
AA Change: L32Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080467
Gene: ENSMUSG00000038615
AA Change: L32Q

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107657
AA Change: L32Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103284
Gene: ENSMUSG00000038615
AA Change: L32Q

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107658
AA Change: L32Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103285
Gene: ENSMUSG00000038615
AA Change: L32Q

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107659
AA Change: L32Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103286
Gene: ENSMUSG00000038615
AA Change: L32Q

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 697 1.93e-7 SMART
transmembrane domain 719 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126949
SMART Domains Protein: ENSMUSP00000120512
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
SCOP:d1e5xa_ 22 65 4e-3 SMART
low complexity region 114 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140138
Predicted Effect probably benign
Transcript: ENSMUST00000142065
SMART Domains Protein: ENSMUSP00000121423
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167110
SMART Domains Protein: ENSMUSP00000127804
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-9 PDB
low complexity region 244 257 N/A INTRINSIC
low complexity region 287 334 N/A INTRINSIC
BRLZ 463 527 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167149
AA Change: L32Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128527
Gene: ENSMUSG00000038615
AA Change: L32Q

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169828
SMART Domains Protein: ENSMUSP00000131585
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
low complexity region 114 127 N/A INTRINSIC
low complexity region 157 204 N/A INTRINSIC
BRLZ 333 397 9.8e-9 SMART
Meta Mutation Damage Score 0.4645 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in globin gene expression in erythrocytes. Confusion has occurred in bibliographic databases from the use of NRF1 for this gene, NFE2L1, and for "nuclear respiratory factor 1" which has an official symbol of NRF1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations fail to form a primitive streak, lack mesoderm, show a non-cell autonomous defect in definitive erythropoiesis, and die around embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Nfe2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Nfe2l1 APN 11 96817716 missense probably benign 0.23
IGL02676:Nfe2l1 APN 11 96827665 missense probably damaging 0.97
IGL02868:Nfe2l1 APN 11 96820140 missense probably damaging 1.00
IGL03278:Nfe2l1 APN 11 96822192 missense probably benign 0.04
R0453:Nfe2l1 UTSW 11 96827368 missense probably damaging 0.99
R0637:Nfe2l1 UTSW 11 96827688 missense probably damaging 1.00
R3891:Nfe2l1 UTSW 11 96819997 missense possibly damaging 0.93
R4108:Nfe2l1 UTSW 11 96819394 critical splice donor site probably null
R4234:Nfe2l1 UTSW 11 96819909 missense probably damaging 1.00
R4720:Nfe2l1 UTSW 11 96827689 missense probably damaging 1.00
R5102:Nfe2l1 UTSW 11 96822108 missense probably damaging 0.99
R5319:Nfe2l1 UTSW 11 96819379 missense probably damaging 0.98
R5929:Nfe2l1 UTSW 11 96827359 missense probably damaging 0.99
R6263:Nfe2l1 UTSW 11 96817744 missense probably benign 0.23
R6375:Nfe2l1 UTSW 11 96820051 missense probably damaging 1.00
R6450:Nfe2l1 UTSW 11 96827335 missense possibly damaging 0.80
R6705:Nfe2l1 UTSW 11 96827625 missense probably damaging 1.00
R6907:Nfe2l1 UTSW 11 96819810 missense probably damaging 1.00
R7161:Nfe2l1 UTSW 11 96817720 missense probably benign 0.23
R7411:Nfe2l1 UTSW 11 96822183 missense probably benign 0.37
R7420:Nfe2l1 UTSW 11 96819913 missense probably benign 0.02
R7495:Nfe2l1 UTSW 11 96819796 missense probably damaging 0.98
R7625:Nfe2l1 UTSW 11 96819445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGCATTGACCTCAGTGGTAG -3'
(R):5'- GGAAAAGTGAATGTGGCTTTCGCTC -3'

Sequencing Primer
(F):5'- GTAGGCACCTGGAACCTATC -3'
(R):5'- GTAGCCTGCTGGCTGAAG -3'
Posted On2013-05-09