Incidental Mutation 'R0218:Osr1'
ID 33676
Institutional Source Beutler Lab
Gene Symbol Osr1
Ensembl Gene ENSMUSG00000048387
Gene Name odd-skipped related transcription factor 1
Synonyms Odd1
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock # R0218 (G1)
Quality Score 199
Status Validated
Chromosome 12
Chromosomal Location 9570116-9581500 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9579639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 171 (T171A)
Ref Sequence ENSEMBL: ENSMUSP00000055486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057021] [ENSMUST00000217975]
AlphaFold Q9WVG7
Predicted Effect probably benign
Transcript: ENSMUST00000057021
AA Change: T171A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055486
Gene: ENSMUSG00000048387
AA Change: T171A

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
ZnF_C2H2 175 197 1.67e-2 SMART
ZnF_C2H2 203 225 2.4e-3 SMART
ZnF_C2H2 231 253 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217975
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation fail to form atrial septum and exhibit dilated atria with hypoplastic venous valves and blood backflow from the heart into systemic veins. Complete agenesis of adrenal glands, metanephric kidneys, gonads, and defects in pericardium formation are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Osr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Osr1 APN 12 9579432 missense probably benign 0.00
IGL01508:Osr1 APN 12 9579370 missense probably damaging 1.00
IGL02583:Osr1 APN 12 9579675 missense probably damaging 1.00
R0077:Osr1 UTSW 12 9579691 missense probably damaging 1.00
R1223:Osr1 UTSW 12 9579699 missense probably damaging 1.00
R1568:Osr1 UTSW 12 9579798 splice site probably null
R1924:Osr1 UTSW 12 9579268 missense probably damaging 1.00
R1939:Osr1 UTSW 12 9579687 missense probably damaging 1.00
R5580:Osr1 UTSW 12 9579325 missense probably damaging 0.99
R7713:Osr1 UTSW 12 9579253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCCTCGCTTTGATTTCGCTAAC -3'
(R):5'- GGAATGCTTACAGCCACTGGAGAC -3'

Sequencing Primer
(F):5'- TAACCTGGCCTTGGCTGC -3'
(R):5'- TACAGCCACTGGAGACTCTTG -3'
Posted On 2013-05-09