Incidental Mutation 'R0218:Simc1'
ID33683
Institutional Source Beutler Lab
Gene Symbol Simc1
Ensembl Gene ENSMUSG00000043183
Gene NameSUMO-interacting motifs containing 1
Synonyms4732471D19Rik
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0218 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54503779-54551290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54526604 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 922 (Y922H)
Ref Sequence ENSEMBL: ENSMUSP00000113676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118072] [ENSMUST00000121401] [ENSMUST00000138869] [ENSMUST00000159721]
Predicted Effect probably benign
Transcript: ENSMUST00000118072
SMART Domains Protein: ENSMUSP00000112376
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 167 179 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 425 443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121401
AA Change: Y922H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113676
Gene: ENSMUSG00000043183
AA Change: Y922H

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
internal_repeat_1 268 491 3.21e-17 PROSPERO
internal_repeat_1 579 832 3.21e-17 PROSPERO
low complexity region 852 868 N/A INTRINSIC
low complexity region 1068 1080 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1326 1344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123852
Predicted Effect probably benign
Transcript: ENSMUST00000138869
SMART Domains Protein: ENSMUSP00000124474
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150011
Predicted Effect probably benign
Transcript: ENSMUST00000159721
SMART Domains Protein: ENSMUSP00000124921
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
Meta Mutation Damage Score 0.1770 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Simc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Simc1 APN 13 54525176 missense probably benign 0.27
IGL00813:Simc1 APN 13 54546986 missense probably damaging 0.98
IGL01326:Simc1 APN 13 54524660 missense probably benign 0.00
IGL01587:Simc1 APN 13 54539704 missense probably damaging 1.00
IGL02887:Simc1 APN 13 54525258 missense probably benign 0.04
IGL02977:Simc1 APN 13 54526307 missense probably benign 0.15
IGL03051:Simc1 APN 13 54526223 missense probably benign 0.15
IGL03065:Simc1 APN 13 54537212 missense probably damaging 1.00
IGL03244:Simc1 APN 13 54550629 missense probably benign 0.06
R0158:Simc1 UTSW 13 54524717 missense probably benign 0.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0241:Simc1 UTSW 13 54550525 missense probably damaging 1.00
R0362:Simc1 UTSW 13 54528467 missense probably damaging 1.00
R0464:Simc1 UTSW 13 54537100 nonsense probably null
R0556:Simc1 UTSW 13 54525347 missense probably benign 0.16
R0616:Simc1 UTSW 13 54547032 missense probably benign 0.03
R0686:Simc1 UTSW 13 54525190 missense probably benign 0.31
R0715:Simc1 UTSW 13 54525655 missense possibly damaging 0.49
R0761:Simc1 UTSW 13 54526574 missense probably damaging 1.00
R1335:Simc1 UTSW 13 54525265 intron probably benign
R1344:Simc1 UTSW 13 54550479 missense probably damaging 1.00
R1345:Simc1 UTSW 13 54525247 intron probably benign
R1585:Simc1 UTSW 13 54525258 missense probably benign 0.04
R1633:Simc1 UTSW 13 54525231 missense probably benign 0.05
R1725:Simc1 UTSW 13 54526406 missense probably damaging 0.99
R1826:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1827:Simc1 UTSW 13 54524639 missense probably benign 0.00
R1893:Simc1 UTSW 13 54539715 missense probably damaging 0.99
R2012:Simc1 UTSW 13 54503888 missense probably benign 0.05
R2088:Simc1 UTSW 13 54541534 missense probably damaging 1.00
R2901:Simc1 UTSW 13 54541518 unclassified probably null
R2974:Simc1 UTSW 13 54550461 missense probably damaging 1.00
R4238:Simc1 UTSW 13 54526260 nonsense probably null
R4870:Simc1 UTSW 13 54539763 missense probably null 0.73
R4959:Simc1 UTSW 13 54525318 missense possibly damaging 0.49
R5104:Simc1 UTSW 13 54526362 missense probably benign 0.15
R5217:Simc1 UTSW 13 54539896 unclassified probably benign
R5319:Simc1 UTSW 13 54524982 missense probably benign 0.00
R5635:Simc1 UTSW 13 54525404 missense probably benign 0.00
R5660:Simc1 UTSW 13 54547089 missense probably benign 0.01
R5900:Simc1 UTSW 13 54547024 missense probably damaging 1.00
R5963:Simc1 UTSW 13 54525819 missense possibly damaging 0.84
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6036:Simc1 UTSW 13 54524621 missense probably benign 0.01
R6089:Simc1 UTSW 13 54528490 missense probably benign 0.30
R6271:Simc1 UTSW 13 54539724 missense probably damaging 1.00
R6322:Simc1 UTSW 13 54550569 missense probably damaging 1.00
R6364:Simc1 UTSW 13 54524600 nonsense probably null
R6434:Simc1 UTSW 13 54526664 missense probably benign 0.22
R6627:Simc1 UTSW 13 54547074 missense probably damaging 1.00
R6758:Simc1 UTSW 13 54525548 missense possibly damaging 0.57
R7236:Simc1 UTSW 13 54524796 missense probably benign 0.03
R7297:Simc1 UTSW 13 54525235 intron probably benign
R7359:Simc1 UTSW 13 54503918 missense unknown
R7362:Simc1 UTSW 13 54539704 missense probably damaging 1.00
R7490:Simc1 UTSW 13 54524349 missense possibly damaging 0.84
R7792:Simc1 UTSW 13 54547330 missense probably damaging 1.00
R7855:Simc1 UTSW 13 54524832 missense probably benign 0.03
R7869:Simc1 UTSW 13 54503900 missense unknown
R7938:Simc1 UTSW 13 54524832 missense probably benign 0.03
R7952:Simc1 UTSW 13 54503900 missense unknown
X0023:Simc1 UTSW 13 54541531 missense probably damaging 0.98
Z1177:Simc1 UTSW 13 54524445 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCCCGAATGATGTGCAGAATCG -3'
(R):5'- TTTGGCCCATTCTCTGGCATGGAC -3'

Sequencing Primer
(F):5'- AAGTTGCTCTGCTAACCCAC -3'
(R):5'- ATTCTCTGGCATGGACTCTAATC -3'
Posted On2013-05-09