Incidental Mutation 'R0218:Cd200r1'
ID33688
Institutional Source Beutler Lab
Gene Symbol Cd200r1
Ensembl Gene ENSMUSG00000022667
Gene NameCD200 receptor 1
SynonymsMox2r, OX2R, CD200R
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0218 (G1)
Quality Score208
Status Validated
Chromosome16
Chromosomal Location44765736-44794978 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 44788743 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057488] [ENSMUST00000134625] [ENSMUST00000231633]
Predicted Effect probably benign
Transcript: ENSMUST00000057488
SMART Domains Protein: ENSMUSP00000053822
Gene: ENSMUSG00000022667

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-47 BLAST
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134625
SMART Domains Protein: ENSMUSP00000138076
Gene: ENSMUSG00000022667

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231633
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display abnormal sleep patterns including fragmented vigilance states and diminished duration of wakefulness. Mice homozygous for a different knock-out allele exhibit protection from HSV-1 encephalitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Cd200r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Cd200r1 APN 16 44794309 missense possibly damaging 0.88
IGL02111:Cd200r1 APN 16 44788781 missense probably damaging 0.99
IGL02549:Cd200r1 APN 16 44789978 missense probably damaging 1.00
IGL03065:Cd200r1 APN 16 44794282 missense probably benign 0.00
R1512:Cd200r1 UTSW 16 44766027 missense probably benign 0.21
R3605:Cd200r1 UTSW 16 44789576 missense possibly damaging 0.90
R3877:Cd200r1 UTSW 16 44790011 missense possibly damaging 0.82
R3963:Cd200r1 UTSW 16 44792795 missense probably benign 0.03
R4109:Cd200r1 UTSW 16 44790084 missense possibly damaging 0.95
R4171:Cd200r1 UTSW 16 44792764 missense probably damaging 0.98
R4296:Cd200r1 UTSW 16 44789670 missense probably damaging 0.98
R4396:Cd200r1 UTSW 16 44766054 missense probably benign 0.01
R4922:Cd200r1 UTSW 16 44789676 missense probably damaging 1.00
R5090:Cd200r1 UTSW 16 44789561 missense possibly damaging 0.79
R5302:Cd200r1 UTSW 16 44792809 missense possibly damaging 0.86
R5686:Cd200r1 UTSW 16 44790164 missense probably damaging 1.00
R5838:Cd200r1 UTSW 16 44766034 missense possibly damaging 0.75
R5886:Cd200r1 UTSW 16 44790203 missense possibly damaging 0.75
R5913:Cd200r1 UTSW 16 44789671 missense possibly damaging 0.50
R6529:Cd200r1 UTSW 16 44789702 missense possibly damaging 0.81
R6959:Cd200r1 UTSW 16 44790176 missense probably damaging 0.99
R7185:Cd200r1 UTSW 16 44789612 missense probably benign 0.30
R7211:Cd200r1 UTSW 16 44788757 missense probably benign 0.00
R7386:Cd200r1 UTSW 16 44789848 missense probably benign 0.33
R7773:Cd200r1 UTSW 16 44789687 missense possibly damaging 0.69
RF007:Cd200r1 UTSW 16 44790011 missense possibly damaging 0.82
Z1176:Cd200r1 UTSW 16 44792759 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGCCTACAAAGGACCTGGCAAG -3'
(R):5'- TGGGAGGGTGATAATGCCACAGTC -3'

Sequencing Primer
(F):5'- AAGGAAGGCAGGGCTACTG -3'
(R):5'- AAGTGTTCAGGGTCCCTCAC -3'
Posted On2013-05-09