Incidental Mutation 'R0218:Sncaip'
ID33692
Institutional Source Beutler Lab
Gene Symbol Sncaip
Ensembl Gene ENSMUSG00000024534
Gene Namesynuclein, alpha interacting protein (synphilin)
Synonymssynphilin-1, 4933427B05Rik, SYPH1
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R0218 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location52767709-52915935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52907328 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 805 (S805G)
Ref Sequence ENSEMBL: ENSMUSP00000136838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025413] [ENSMUST00000115410] [ENSMUST00000163742] [ENSMUST00000177861] [ENSMUST00000178011] [ENSMUST00000178678] [ENSMUST00000178883] [ENSMUST00000179625] [ENSMUST00000179689] [ENSMUST00000180259]
Predicted Effect probably benign
Transcript: ENSMUST00000025413
AA Change: S865G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025413
Gene: ENSMUSG00000024534
AA Change: S865G

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115410
AA Change: S865G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111069
Gene: ENSMUSG00000024534
AA Change: S865G

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163742
AA Change: S865G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127189
Gene: ENSMUSG00000024534
AA Change: S865G

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177861
Predicted Effect probably benign
Transcript: ENSMUST00000178011
AA Change: S865G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137549
Gene: ENSMUSG00000024534
AA Change: S865G

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178678
AA Change: S865G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137367
Gene: ENSMUSG00000024534
AA Change: S865G

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
Pfam:SNCAIP_SNCA_bd 511 556 7.9e-30 PFAM
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178883
Predicted Effect probably benign
Transcript: ENSMUST00000179625
AA Change: S805G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136838
Gene: ENSMUSG00000024534
AA Change: S805G

DomainStartEndE-ValueType
ANK 358 387 5.03e2 SMART
ANK 395 424 4.26e-4 SMART
PDB:2KES|A 451 489 9e-10 PDB
low complexity region 490 511 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 809 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179689
AA Change: S453G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137107
Gene: ENSMUSG00000024534
AA Change: S453G

DomainStartEndE-ValueType
ANK 43 72 4.26e-4 SMART
PDB:2KES|A 99 137 6e-10 PDB
low complexity region 138 159 N/A INTRINSIC
low complexity region 244 257 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 333 343 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 457 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180259
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several protein-protein interaction domains, including ankyrin-like repeats, a coiled-coil domain, and an ATP/GTP-binding motif. The encoded protein interacts with alpha-synuclein in neuronal tissue and may play a role in the formation of cytoplasmic inclusions and neurodegeneration. A mutation in this gene has been associated with Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Sncaip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Sncaip APN 18 52884963 intron probably null
IGL01554:Sncaip APN 18 52868934 missense possibly damaging 0.94
IGL01802:Sncaip APN 18 52869037 missense probably damaging 1.00
IGL02658:Sncaip APN 18 52894955 missense possibly damaging 0.50
IGL02737:Sncaip APN 18 52907056 missense probably benign 0.10
IGL03017:Sncaip APN 18 52894937 missense possibly damaging 0.82
PIT4445001:Sncaip UTSW 18 52868944 missense probably damaging 1.00
R0325:Sncaip UTSW 18 52905809 missense probably damaging 1.00
R0450:Sncaip UTSW 18 52868709 missense probably benign 0.08
R0469:Sncaip UTSW 18 52868709 missense probably benign 0.08
R1494:Sncaip UTSW 18 52868886 missense probably damaging 0.99
R1897:Sncaip UTSW 18 52894790 intron probably null
R1962:Sncaip UTSW 18 52871362 missense probably damaging 1.00
R2238:Sncaip UTSW 18 52868547 missense probably damaging 1.00
R2935:Sncaip UTSW 18 52838032 missense probably damaging 1.00
R4044:Sncaip UTSW 18 52907403 missense probably benign 0.01
R4694:Sncaip UTSW 18 52906557 missense probably benign 0.00
R4810:Sncaip UTSW 18 52907199 missense possibly damaging 0.47
R4850:Sncaip UTSW 18 52871384 missense probably damaging 1.00
R4857:Sncaip UTSW 18 52869225 missense probably benign 0.00
R4939:Sncaip UTSW 18 52907263 missense possibly damaging 0.53
R5384:Sncaip UTSW 18 52885041 missense probably damaging 1.00
R5610:Sncaip UTSW 18 52868919 missense probably benign
R5645:Sncaip UTSW 18 52894956 missense probably damaging 1.00
R5797:Sncaip UTSW 18 52898204 missense probably benign 0.28
R5977:Sncaip UTSW 18 52869321 missense probably benign
R6197:Sncaip UTSW 18 52906894 missense probably damaging 1.00
R6369:Sncaip UTSW 18 52868604 missense probably damaging 0.98
R6505:Sncaip UTSW 18 52906537 nonsense probably null
R6604:Sncaip UTSW 18 52905846 missense possibly damaging 0.71
R6880:Sncaip UTSW 18 52869064 missense probably damaging 1.00
R7215:Sncaip UTSW 18 52907343 nonsense probably null
R7234:Sncaip UTSW 18 52915344 missense probably benign 0.00
Z1177:Sncaip UTSW 18 52907425 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGCCCAGAAAGTTGCCACAAGC -3'
(R):5'- TCTCTGCATTCTCCACAGTGCAAG -3'

Sequencing Primer
(F):5'- AGAGTGCCCTCAAGTCTCC -3'
(R):5'- GCCAGTAACCAGGGTTTTAAC -3'
Posted On2013-05-09