Incidental Mutation 'R0218:Cdx1'
ID33693
Institutional Source Beutler Lab
Gene Symbol Cdx1
Ensembl Gene ENSMUSG00000024619
Gene Namecaudal type homeobox 1
SynonymsCdx-1, Cdx
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock #R0218 (G1)
Quality Score130
Status Validated
Chromosome18
Chromosomal Location61018862-61036199 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 61020364 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025521]
Predicted Effect probably benign
Transcript: ENSMUST00000025521
SMART Domains Protein: ENSMUSP00000025521
Gene: ENSMUSG00000024619

DomainStartEndE-ValueType
Pfam:Caudal_act 13 146 4.8e-31 PFAM
HOX 154 216 1.3e-25 SMART
low complexity region 217 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the caudal-related homeobox transcription factor gene family. The encoded DNA-binding protein regulates intestine-specific gene expression and enterocyte differentiation. It has been shown to induce expression of the intestinal alkaline phosphatase gene, and inhibit beta-catenin/T-cell factor transcriptional activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormalities of the basiocciptal bone, vertebrae, and ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Cdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0370:Cdx1 UTSW 18 61020429 missense probably damaging 1.00
FR4449:Cdx1 UTSW 18 61019881 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019874 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019878 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019867 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019869 small insertion probably benign
R0481:Cdx1 UTSW 18 61020492 missense probably damaging 1.00
R1776:Cdx1 UTSW 18 61036014 missense probably benign 0.01
R1914:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R1915:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R2094:Cdx1 UTSW 18 61035912 missense possibly damaging 0.85
R4191:Cdx1 UTSW 18 61020438 missense possibly damaging 0.88
R5671:Cdx1 UTSW 18 61019899 missense probably benign 0.01
RF036:Cdx1 UTSW 18 61019870 small insertion probably benign
RF038:Cdx1 UTSW 18 61019870 small insertion probably benign
RF039:Cdx1 UTSW 18 61019870 small insertion probably benign
RF040:Cdx1 UTSW 18 61019870 small insertion probably benign
RF049:Cdx1 UTSW 18 61019866 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CATTGATTACCAGCCACTGTAGCCC -3'
(R):5'- TCCATCAGCTTTCAGTCAGGCG -3'

Sequencing Primer
(F):5'- ACTGTAGCCCGTGgtatgtg -3'
(R):5'- TTCAGTCAGGCGCTGTC -3'
Posted On2013-05-09