Incidental Mutation 'R0218:1700017D01Rik'
ID33694
Institutional Source Beutler Lab
Gene Symbol 1700017D01Rik
Ensembl Gene ENSMUSG00000024729
Gene NameRIKEN cDNA 1700017D01 gene
Synonyms
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0218 (G1)
Quality Score200
Status Validated
Chromosome19
Chromosomal Location11096816-11130876 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 11116437 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 10 (Y10*)
Ref Sequence ENSEMBL: ENSMUSP00000025635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025635]
Predicted Effect probably null
Transcript: ENSMUST00000025635
AA Change: Y10*
SMART Domains Protein: ENSMUSP00000025635
Gene: ENSMUSG00000024729
AA Change: Y10*

DomainStartEndE-ValueType
Pfam:CD20 18 118 2.4e-8 PFAM
transmembrane domain 130 152 N/A INTRINSIC
low complexity region 169 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188756
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in 1700017D01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:1700017D01Rik APN 19 11110331 nonsense probably null
IGL02182:1700017D01Rik APN 19 11097072 splice site probably benign
IGL03156:1700017D01Rik APN 19 11105750 missense possibly damaging 0.80
R0189:1700017D01Rik UTSW 19 11096947 missense possibly damaging 0.46
R0464:1700017D01Rik UTSW 19 11112437 missense probably damaging 1.00
R0617:1700017D01Rik UTSW 19 11112400 missense probably damaging 1.00
R1171:1700017D01Rik UTSW 19 11112377 missense probably damaging 0.97
R2341:1700017D01Rik UTSW 19 11105793 missense probably benign
R5099:1700017D01Rik UTSW 19 11112461 critical splice acceptor site probably null
R5330:1700017D01Rik UTSW 19 11091858 unclassified probably benign
R5331:1700017D01Rik UTSW 19 11091858 unclassified probably benign
R5341:1700017D01Rik UTSW 19 11110381 intron probably benign
R6109:1700017D01Rik UTSW 19 11101912 missense possibly damaging 0.66
R6177:1700017D01Rik UTSW 19 11105750 missense possibly damaging 0.53
R6970:1700017D01Rik UTSW 19 11112314 critical splice donor site probably null
R7038:1700017D01Rik UTSW 19 11110311 missense probably benign
R7584:1700017D01Rik UTSW 19 11110361 missense possibly damaging 0.94
R7752:1700017D01Rik UTSW 19 11101860 missense probably benign 0.02
R7854:1700017D01Rik UTSW 19 11112377 missense probably benign 0.01
R7937:1700017D01Rik UTSW 19 11112377 missense probably benign 0.01
X0019:1700017D01Rik UTSW 19 11105792 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGTTTTGTGTGACCATTTAGCTCTGG -3'
(R):5'- CAGAACTGCTGCTCTTAGGTAAGACC -3'

Sequencing Primer
(F):5'- GACCATTTAGCTCTGGTATAATTGTC -3'
(R):5'- atttagttctcagcacacacatc -3'
Posted On2013-05-09