Incidental Mutation 'R0218:Olfr1499'
ID33695
Institutional Source Beutler Lab
Gene Symbol Olfr1499
Ensembl Gene ENSMUSG00000045395
Gene Nameolfactory receptor 1499
SynonymsMOR211-2, GA_x6K02T2RE5P-4147744-4146800
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R0218 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13814275-13819447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13814978 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 204 (N204S)
Ref Sequence ENSEMBL: ENSMUSP00000150330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055672] [ENSMUST00000216659]
Predicted Effect probably benign
Transcript: ENSMUST00000055672
AA Change: N204S

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059747
Gene: ENSMUSG00000045395
AA Change: N204S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-44 PFAM
Pfam:7tm_1 41 290 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216659
AA Change: N204S

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1249 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Zfp518a A G 19: 40,912,628 T334A probably benign Het
Other mutations in Olfr1499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1499 APN 19 13815302 missense probably benign 0.09
IGL01844:Olfr1499 APN 19 13814816 missense possibly damaging 0.95
IGL03102:Olfr1499 APN 19 13815371 missense probably damaging 1.00
IGL03352:Olfr1499 APN 19 13814928 missense probably damaging 1.00
R0490:Olfr1499 UTSW 19 13814855 missense probably damaging 1.00
R0682:Olfr1499 UTSW 19 13815137 missense possibly damaging 0.94
R1301:Olfr1499 UTSW 19 13815362 missense probably damaging 1.00
R1328:Olfr1499 UTSW 19 13815536 missense probably benign 0.01
R2100:Olfr1499 UTSW 19 13815236 missense possibly damaging 0.95
R3701:Olfr1499 UTSW 19 13815348 missense probably benign 0.03
R4563:Olfr1499 UTSW 19 13815282 missense probably benign 0.01
R4709:Olfr1499 UTSW 19 13815450 missense possibly damaging 0.94
R5231:Olfr1499 UTSW 19 13815347 missense probably damaging 0.99
R5301:Olfr1499 UTSW 19 13815569 missense probably damaging 0.99
R5343:Olfr1499 UTSW 19 13814960 missense probably damaging 1.00
R6268:Olfr1499 UTSW 19 13815307 nonsense probably null
R6442:Olfr1499 UTSW 19 13815628 start gained probably benign
R7132:Olfr1499 UTSW 19 13815422 missense probably benign 0.09
R7764:Olfr1499 UTSW 19 13814747 missense probably benign 0.01
Z1088:Olfr1499 UTSW 19 13815548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTAGTGAGCTTTCTGAAGCC -3'
(R):5'- TGTGTTGGATGCCTGCTACACC -3'

Sequencing Primer
(F):5'- GGCGATTTCCCTGAACCAC -3'
(R):5'- CTGTGCAAGTACAGAATGTTTCCTG -3'
Posted On2013-05-09