Incidental Mutation 'R0219:Ddx59'
ID33700
Institutional Source Beutler Lab
Gene Symbol Ddx59
Ensembl Gene ENSMUSG00000026404
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Synonyms
MMRRC Submission 038468-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0219 (G1)
Quality Score119
Status Validated
Chromosome1
Chromosomal Location136415271-136440158 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 136432309 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027655]
Predicted Effect probably benign
Transcript: ENSMUST00000027655
SMART Domains Protein: ENSMUSP00000027655
Gene: ENSMUSG00000026404

DomainStartEndE-ValueType
Pfam:zf-HIT 104 133 5.5e-11 PFAM
DEXDc 222 420 5.43e-55 SMART
HELICc 458 540 1.79e-23 SMART
low complexity region 583 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149783
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,886,150 probably benign Het
Acacb T A 5: 114,232,944 M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,811,040 probably benign Het
Ankle2 C T 5: 110,251,645 R624* probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Brca2 A G 5: 150,523,175 probably benign Het
Ccdc116 T A 16: 17,141,612 R404S possibly damaging Het
Ccdc171 A G 4: 83,696,441 probably benign Het
Ccdc80 A G 16: 45,096,483 K534R probably damaging Het
Ccna1 T C 3: 55,050,927 I112V probably benign Het
Cdhr1 A C 14: 37,079,601 L795R possibly damaging Het
Cilp C A 9: 65,269,590 L43I possibly damaging Het
Dclk2 T C 3: 86,813,669 probably benign Het
Dgkd T C 1: 87,938,274 probably benign Het
Dicer1 A G 12: 104,692,125 probably null Het
Dst T G 1: 34,303,478 S5030A probably damaging Het
Dysf G A 6: 84,129,461 probably benign Het
Farp1 C A 14: 121,243,600 P471Q possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer1g A G 1: 171,231,226 V31A possibly damaging Het
Glb1l2 A G 9: 26,806,322 V21A probably benign Het
Gm9912 T C 3: 149,185,495 I1V unknown Het
Guf1 G A 5: 69,559,586 A164T probably damaging Het
Hbb-bs T C 7: 103,826,669 H147R possibly damaging Het
Hnrnpr T A 4: 136,339,163 probably benign Het
Iglon5 A T 7: 43,476,837 V214E probably damaging Het
Isx C A 8: 74,889,961 probably null Het
Kank4 T C 4: 98,778,465 N582D probably benign Het
Kcp T A 6: 29,495,785 R773W probably damaging Het
Kdm4c T C 4: 74,373,620 C825R probably damaging Het
Krt25 G A 11: 99,318,059 T315M probably benign Het
Lrp5 A T 19: 3,597,349 S1298T probably damaging Het
Map3k10 T C 7: 27,656,731 D921G probably damaging Het
Mrgprx1 C A 7: 48,021,546 W151L probably damaging Het
Mylk3 T A 8: 85,355,244 D375V probably damaging Het
Nav3 C T 10: 109,866,930 probably null Het
Ncan A G 8: 70,115,334 S43P probably benign Het
Necab3 G T 2: 154,546,093 Q292K probably benign Het
Nptx2 T C 5: 144,548,140 S148P probably damaging Het
Olfr414 G A 1: 174,430,466 V13I probably benign Het
Olfr520 A T 7: 99,735,928 I262L probably benign Het
Pde6a A G 18: 61,285,935 E794G possibly damaging Het
Pus7 T C 5: 23,775,966 Y133C possibly damaging Het
Rad21l A G 2: 151,654,588 probably benign Het
Rptor A T 11: 119,821,777 probably benign Het
Sart1 C A 19: 5,388,396 A78S probably benign Het
Shkbp1 T C 7: 27,352,061 E191G probably benign Het
Slc6a18 A T 13: 73,674,632 probably null Het
Stxbp5 T C 10: 9,770,528 T147A probably benign Het
Sv2b A G 7: 75,157,267 probably null Het
Syne2 A T 12: 76,042,004 K5045N probably damaging Het
Tmem174 A C 13: 98,636,839 M161R possibly damaging Het
Tmprss7 A G 16: 45,656,457 V814A probably damaging Het
Togaram2 T C 17: 71,714,230 probably benign Het
Tpr T C 1: 150,443,258 probably null Het
Ttn T C 2: 76,900,228 probably benign Het
Ubr4 T A 4: 139,430,257 L2375Q possibly damaging Het
Utp20 T C 10: 88,764,675 E1987G probably damaging Het
Utrn T C 10: 12,684,451 T1365A probably damaging Het
Vmn2r116 T A 17: 23,386,098 Y128* probably null Het
Vmn2r5 A G 3: 64,504,313 V278A probably damaging Het
Vps13d C T 4: 145,105,909 S2809N probably benign Het
Zfp212 G A 6: 47,926,685 R68H probably damaging Het
Zfp442 A T 2: 150,411,240 L33Q probably damaging Het
Zfp629 T C 7: 127,612,083 S185G probably damaging Het
Zfp738 A G 13: 67,683,389 probably benign Het
Other mutations in Ddx59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Ddx59 APN 1 136433827 missense probably damaging 0.99
IGL02191:Ddx59 APN 1 136417158 missense probably damaging 1.00
IGL02525:Ddx59 APN 1 136417005 missense probably benign 0.03
IGL02712:Ddx59 APN 1 136439781 missense probably benign 0.14
R0898:Ddx59 UTSW 1 136416941 missense probably damaging 1.00
R1728:Ddx59 UTSW 1 136417053 missense probably benign
R1729:Ddx59 UTSW 1 136417053 missense probably benign
R1730:Ddx59 UTSW 1 136417053 missense probably benign
R1739:Ddx59 UTSW 1 136417053 missense probably benign
R1762:Ddx59 UTSW 1 136417053 missense probably benign
R1783:Ddx59 UTSW 1 136417053 missense probably benign
R1784:Ddx59 UTSW 1 136417053 missense probably benign
R1785:Ddx59 UTSW 1 136417053 missense probably benign
R1817:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R1818:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R1819:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R2091:Ddx59 UTSW 1 136416709 missense probably benign
R3922:Ddx59 UTSW 1 136416744 missense probably benign
R3923:Ddx59 UTSW 1 136416744 missense probably benign
R3926:Ddx59 UTSW 1 136416744 missense probably benign
R3945:Ddx59 UTSW 1 136434618 missense probably damaging 0.99
R4182:Ddx59 UTSW 1 136439861 missense probably benign 0.01
R4589:Ddx59 UTSW 1 136439742 splice site probably null
R4636:Ddx59 UTSW 1 136432563 missense probably damaging 0.96
R4721:Ddx59 UTSW 1 136417106 missense probably benign 0.00
R5276:Ddx59 UTSW 1 136419448 missense probably damaging 1.00
R6318:Ddx59 UTSW 1 136416872 missense probably damaging 0.99
R7602:Ddx59 UTSW 1 136433821 missense probably benign 0.01
Z1088:Ddx59 UTSW 1 136432451 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTCTCCACGGCAGCAGTGTAAC -3'
(R):5'- TGTCCCCAGTGATGATCCTCACAG -3'

Sequencing Primer
(F):5'- ccttgaactcagtccgcc -3'
(R):5'- TCCTCACAGGATTATGCAGAAG -3'
Posted On2013-05-09