Mutagenetix > Incidental Mutation

Incidental Mutation 'R0219:Tpr'

33701

Institutional Source

Beutler Lab

Gene Symbol

Tpr

Ensembl Gene

ENSMUSG00000006005

Gene Name

translocated promoter region, nuclear basket protein

Synonyms

2610029M07Rik

MMRRC Submission

038468-MU

Accession Numbers

Genbank: NM_133780; MGI: 1922066

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0219 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150392838-150449935 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 150443258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973]

AlphaFold

F6ZDS4

Predicted Effect

probably null
Transcript: ENSMUST00000119161

SMART Domains

Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
coiled coil region	49	370	N/A	INTRINSIC
coiled coil region	423	515	N/A	INTRINSIC
low complexity region	518	534	N/A	INTRINSIC
coiled coil region	539	604	N/A	INTRINSIC
low complexity region	690	703	N/A	INTRINSIC
low complexity region	782	795	N/A	INTRINSIC
low complexity region	811	826	N/A	INTRINSIC
low complexity region	1003	1019	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1036	1167	9.1e-33	PFAM
coiled coil region	1215	1421	N/A	INTRINSIC
coiled coil region	1473	1629	N/A	INTRINSIC
internal_repeat_3	1630	1691	1.48e-5	PROSPERO
low complexity region	1695	1717	N/A	INTRINSIC
low complexity region	1761	1777	N/A	INTRINSIC
internal_repeat_5	1814	1827	5.58e-5	PROSPERO
internal_repeat_3	1819	1881	1.48e-5	PROSPERO
internal_repeat_4	1875	1895	5.58e-5	PROSPERO
internal_repeat_1	1893	1919	2.03e-6	PROSPERO
low complexity region	1920	1933	N/A	INTRINSIC
low complexity region	1942	1981	N/A	INTRINSIC
low complexity region	1989	2014	N/A	INTRINSIC
internal_repeat_4	2017	2036	5.58e-5	PROSPERO
low complexity region	2059	2078	N/A	INTRINSIC
internal_repeat_2	2084	2135	3.95e-6	PROSPERO
internal_repeat_5	2127	2140	5.58e-5	PROSPERO
internal_repeat_1	2154	2179	2.03e-6	PROSPERO
internal_repeat_2	2156	2212	3.95e-6	PROSPERO
low complexity region	2239	2251	N/A	INTRINSIC
low complexity region	2263	2277	N/A	INTRINSIC
low complexity region	2292	2314	N/A	INTRINSIC
low complexity region	2346	2357	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119161

SMART Domains

Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
coiled coil region	49	370	N/A	INTRINSIC
coiled coil region	423	515	N/A	INTRINSIC
low complexity region	518	534	N/A	INTRINSIC
coiled coil region	539	604	N/A	INTRINSIC
low complexity region	690	703	N/A	INTRINSIC
low complexity region	782	795	N/A	INTRINSIC
low complexity region	811	826	N/A	INTRINSIC
low complexity region	1003	1019	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1036	1167	9.1e-33	PFAM
coiled coil region	1215	1421	N/A	INTRINSIC
coiled coil region	1473	1629	N/A	INTRINSIC
internal_repeat_3	1630	1691	1.48e-5	PROSPERO
low complexity region	1695	1717	N/A	INTRINSIC
low complexity region	1761	1777	N/A	INTRINSIC
internal_repeat_5	1814	1827	5.58e-5	PROSPERO
internal_repeat_3	1819	1881	1.48e-5	PROSPERO
internal_repeat_4	1875	1895	5.58e-5	PROSPERO
internal_repeat_1	1893	1919	2.03e-6	PROSPERO
low complexity region	1920	1933	N/A	INTRINSIC
low complexity region	1942	1981	N/A	INTRINSIC
low complexity region	1989	2014	N/A	INTRINSIC
internal_repeat_4	2017	2036	5.58e-5	PROSPERO
low complexity region	2059	2078	N/A	INTRINSIC
internal_repeat_2	2084	2135	3.95e-6	PROSPERO
internal_repeat_5	2127	2140	5.58e-5	PROSPERO
internal_repeat_1	2154	2179	2.03e-6	PROSPERO
internal_repeat_2	2156	2212	3.95e-6	PROSPERO
low complexity region	2239	2251	N/A	INTRINSIC
low complexity region	2263	2277	N/A	INTRINSIC
low complexity region	2292	2314	N/A	INTRINSIC
low complexity region	2346	2357	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124484

SMART Domains

Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
low complexity region	26	38	N/A	INTRINSIC
low complexity region	50	64	N/A	INTRINSIC
low complexity region	79	101	N/A	INTRINSIC
low complexity region	133	144	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000124973

SMART Domains

Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	24	77	N/A	INTRINSIC
coiled coil region	123	444	N/A	INTRINSIC
coiled coil region	497	589	N/A	INTRINSIC
low complexity region	592	608	N/A	INTRINSIC
coiled coil region	613	678	N/A	INTRINSIC
low complexity region	764	777	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	1077	1093	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1112	1240	5.1e-37	PFAM
coiled coil region	1289	1495	N/A	INTRINSIC
low complexity region	1682	1698	N/A	INTRINSIC
internal_repeat_5	1703	1750	8.04e-5	PROSPERO
internal_repeat_3	1704	1765	1.07e-5	PROSPERO
low complexity region	1769	1791	N/A	INTRINSIC
low complexity region	1835	1851	N/A	INTRINSIC
internal_repeat_5	1857	1900	8.04e-5	PROSPERO
internal_repeat_6	1887	1911	8.04e-5	PROSPERO
internal_repeat_3	1893	1955	1.07e-5	PROSPERO
internal_repeat_4	1949	1969	4.1e-5	PROSPERO
internal_repeat_1	1967	1993	1.42e-6	PROSPERO
low complexity region	1994	2007	N/A	INTRINSIC
low complexity region	2016	2055	N/A	INTRINSIC
low complexity region	2063	2088	N/A	INTRINSIC
internal_repeat_4	2091	2110	4.1e-5	PROSPERO
internal_repeat_6	2108	2132	8.04e-5	PROSPERO
low complexity region	2133	2152	N/A	INTRINSIC
internal_repeat_2	2158	2209	2.78e-6	PROSPERO
internal_repeat_1	2228	2253	1.42e-6	PROSPERO
internal_repeat_2	2230	2286	2.78e-6	PROSPERO
low complexity region	2313	2325	N/A	INTRINSIC
low complexity region	2337	2351	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2420	2431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128417

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132257

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150752

Predicted Effect

probably benign
Transcript: ENSMUST00000151563

SMART Domains

Protein: ENSMUSP00000116012
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
coiled coil region	1	27	N/A	INTRINSIC
coiled coil region	79	235	N/A	INTRINSIC
low complexity region	302	324	N/A	INTRINSIC
low complexity region	368	384	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
low complexity region	549	588	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152967

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.3%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	T	12: 118,886,150		probably benign	Het
Acacb	T	A	5: 114,232,944	M1749K	possibly damaging	Het
Aff1	GCTCTCTCTC	GCTCTCTCTCTC	5: 103,811,040		probably benign	Het
Ankle2	C	T	5: 110,251,645	R624*	probably null	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Brca2	A	G	5: 150,523,175		probably benign	Het
Ccdc116	T	A	16: 17,141,612	R404S	possibly damaging	Het
Ccdc171	A	G	4: 83,696,441		probably benign	Het
Ccdc80	A	G	16: 45,096,483	K534R	probably damaging	Het
Ccna1	T	C	3: 55,050,927	I112V	probably benign	Het
Cdhr1	A	C	14: 37,079,601	L795R	possibly damaging	Het
Cilp	C	A	9: 65,269,590	L43I	possibly damaging	Het
Dclk2	T	C	3: 86,813,669		probably benign	Het
Ddx59	C	A	1: 136,432,309		probably benign	Het
Dgkd	T	C	1: 87,938,274		probably benign	Het
Dicer1	A	G	12: 104,692,125		probably null	Het
Dst	T	G	1: 34,303,478	S5030A	probably damaging	Het
Dysf	G	A	6: 84,129,461		probably benign	Het
Farp1	C	A	14: 121,243,600	P471Q	possibly damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fcer1g	A	G	1: 171,231,226	V31A	possibly damaging	Het
Glb1l2	A	G	9: 26,806,322	V21A	probably benign	Het
Gm9912	T	C	3: 149,185,495	I1V	unknown	Het
Guf1	G	A	5: 69,559,586	A164T	probably damaging	Het
Hbb-bs	T	C	7: 103,826,669	H147R	possibly damaging	Het
Hnrnpr	T	A	4: 136,339,163		probably benign	Het
Iglon5	A	T	7: 43,476,837	V214E	probably damaging	Het
Isx	C	A	8: 74,889,961		probably null	Het
Kank4	T	C	4: 98,778,465	N582D	probably benign	Het
Kcp	T	A	6: 29,495,785	R773W	probably damaging	Het
Kdm4c	T	C	4: 74,373,620	C825R	probably damaging	Het
Krt25	G	A	11: 99,318,059	T315M	probably benign	Het
Lrp5	A	T	19: 3,597,349	S1298T	probably damaging	Het
Map3k10	T	C	7: 27,656,731	D921G	probably damaging	Het
Mrgprx1	C	A	7: 48,021,546	W151L	probably damaging	Het
Mylk3	T	A	8: 85,355,244	D375V	probably damaging	Het
Nav3	C	T	10: 109,866,930		probably null	Het
Ncan	A	G	8: 70,115,334	S43P	probably benign	Het
Necab3	G	T	2: 154,546,093	Q292K	probably benign	Het
Nptx2	T	C	5: 144,548,140	S148P	probably damaging	Het
Olfr414	G	A	1: 174,430,466	V13I	probably benign	Het
Olfr520	A	T	7: 99,735,928	I262L	probably benign	Het
Pde6a	A	G	18: 61,285,935	E794G	possibly damaging	Het
Pus7	T	C	5: 23,775,966	Y133C	possibly damaging	Het
Rad21l	A	G	2: 151,654,588		probably benign	Het
Rptor	A	T	11: 119,821,777		probably benign	Het
Sart1	C	A	19: 5,388,396	A78S	probably benign	Het
Shkbp1	T	C	7: 27,352,061	E191G	probably benign	Het
Slc6a18	A	T	13: 73,674,632		probably null	Het
Stxbp5	T	C	10: 9,770,528	T147A	probably benign	Het
Sv2b	A	G	7: 75,157,267		probably null	Het
Syne2	A	T	12: 76,042,004	K5045N	probably damaging	Het
Tmem174	A	C	13: 98,636,839	M161R	possibly damaging	Het
Tmprss7	A	G	16: 45,656,457	V814A	probably damaging	Het
Togaram2	T	C	17: 71,714,230		probably benign	Het
Ttn	T	C	2: 76,900,228		probably benign	Het
Ubr4	T	A	4: 139,430,257	L2375Q	possibly damaging	Het
Utp20	T	C	10: 88,764,675	E1987G	probably damaging	Het
Utrn	T	C	10: 12,684,451	T1365A	probably damaging	Het
Vmn2r116	T	A	17: 23,386,098	Y128*	probably null	Het
Vmn2r5	A	G	3: 64,504,313	V278A	probably damaging	Het
Vps13d	C	T	4: 145,105,909	S2809N	probably benign	Het
Zfp212	G	A	6: 47,926,685	R68H	probably damaging	Het
Zfp442	A	T	2: 150,411,240	L33Q	probably damaging	Het
Zfp629	T	C	7: 127,612,083	S185G	probably damaging	Het
Zfp738	A	G	13: 67,683,389		probably benign	Het

Other mutations in Tpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Tpr	APN	1	150423696	splice site	probably benign
IGL00424:Tpr	APN	1	150398595	splice site	probably benign
IGL01095:Tpr	APN	1	150410140	missense	possibly damaging	0.95
IGL01347:Tpr	APN	1	150426987	missense	probably damaging	1.00
IGL01519:Tpr	APN	1	150431168	missense	probably benign	0.01
IGL01768:Tpr	APN	1	150444448	missense	possibly damaging	0.85
IGL01939:Tpr	APN	1	150413745	missense	possibly damaging	0.82
IGL01988:Tpr	APN	1	150426999	splice site	probably null
IGL02065:Tpr	APN	1	150413774	missense	probably benign	0.13
IGL02110:Tpr	APN	1	150435742	missense	probably damaging	0.97
IGL02311:Tpr	APN	1	150398653	missense	probably damaging	0.97
IGL02454:Tpr	APN	1	150431192	missense	probably benign	0.00
IGL02569:Tpr	APN	1	150425631	unclassified	probably benign
IGL03168:Tpr	APN	1	150408757	missense	probably benign	0.04
IGL03193:Tpr	APN	1	150440080	missense	possibly damaging	0.85
IGL03333:Tpr	APN	1	150426967	missense	probably benign	0.04
gridiron	UTSW	1	150423516	missense	probably damaging	1.00
Pouch	UTSW	1	150433772	missense	probably damaging	1.00
punt	UTSW	1	150418039	missense	probably benign	0.02
Turf	UTSW	1	150442245	critical splice donor site	probably null
F6893:Tpr	UTSW	1	150393562	missense	possibly damaging	0.84
PIT4305001:Tpr	UTSW	1	150440137	missense	possibly damaging	0.85
PIT4469001:Tpr	UTSW	1	150403956	missense	probably benign	0.41
R0085:Tpr	UTSW	1	150417413	missense	possibly damaging	0.95
R0101:Tpr	UTSW	1	150409302	splice site	probably benign
R0116:Tpr	UTSW	1	150410147	missense	probably damaging	0.98
R0136:Tpr	UTSW	1	150430595	missense	probably benign	0.01
R0207:Tpr	UTSW	1	150417427	missense	possibly damaging	0.74
R0380:Tpr	UTSW	1	150412947	missense	probably benign	0.27
R0403:Tpr	UTSW	1	150407414	splice site	probably benign
R0469:Tpr	UTSW	1	150423667	frame shift	probably null
R0480:Tpr	UTSW	1	150428241	missense	possibly damaging	0.83
R0514:Tpr	UTSW	1	150402273	missense	possibly damaging	0.55
R0563:Tpr	UTSW	1	150408858	missense	probably benign	0.13
R0631:Tpr	UTSW	1	150422531	missense	probably damaging	0.98
R0685:Tpr	UTSW	1	150433725	missense	possibly damaging	0.69
R0730:Tpr	UTSW	1	150393407	utr 5 prime	probably benign
R0739:Tpr	UTSW	1	150407497	missense	possibly damaging	0.94
R0780:Tpr	UTSW	1	150431341	missense	probably benign	0.00
R1018:Tpr	UTSW	1	150442183	missense	possibly damaging	0.53
R1084:Tpr	UTSW	1	150442161	missense	probably benign	0.18
R1532:Tpr	UTSW	1	150418000	missense	probably damaging	0.99
R1551:Tpr	UTSW	1	150436801	missense	probably benign	0.00
R1608:Tpr	UTSW	1	150426893	missense	probably damaging	0.96
R1759:Tpr	UTSW	1	150429524	missense	probably benign	0.19
R1817:Tpr	UTSW	1	150419903	missense	probably damaging	0.98
R1932:Tpr	UTSW	1	150421663	missense	probably benign	0.00
R1978:Tpr	UTSW	1	150419907	missense	possibly damaging	0.65
R2031:Tpr	UTSW	1	150442119	missense	probably benign
R2176:Tpr	UTSW	1	150419940	missense	possibly damaging	0.56
R2235:Tpr	UTSW	1	150442092	missense	probably benign	0.33
R2339:Tpr	UTSW	1	150413774	missense	probably benign	0.01
R2367:Tpr	UTSW	1	150433728	missense	probably damaging	0.99
R2507:Tpr	UTSW	1	150392944	start codon destroyed	probably null
R3931:Tpr	UTSW	1	150435904	missense	probably damaging	1.00
R4320:Tpr	UTSW	1	150423574	missense	possibly damaging	0.96
R4439:Tpr	UTSW	1	150403961	missense	probably benign	0.01
R4568:Tpr	UTSW	1	150392959	unclassified	probably benign
R4644:Tpr	UTSW	1	150423499	missense	probably benign	0.01
R4665:Tpr	UTSW	1	150444399	missense	probably damaging	0.97
R4672:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4673:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4735:Tpr	UTSW	1	150442196	missense	possibly damaging	0.91
R4767:Tpr	UTSW	1	150430529	intron	probably benign
R4772:Tpr	UTSW	1	150413113	missense	possibly damaging	0.46
R4815:Tpr	UTSW	1	150398608	missense	probably benign	0.01
R4839:Tpr	UTSW	1	150449197	nonsense	probably null
R4844:Tpr	UTSW	1	150445879	missense	possibly damaging	0.86
R4925:Tpr	UTSW	1	150432565	missense	probably benign	0.00
R4967:Tpr	UTSW	1	150410059	missense	probably damaging	0.99
R5017:Tpr	UTSW	1	150398637	missense	probably benign	0.00
R5096:Tpr	UTSW	1	150446202	missense	probably damaging	0.99
R5353:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5354:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5484:Tpr	UTSW	1	150426888	missense	probably benign	0.33
R5601:Tpr	UTSW	1	150435853	missense	possibly damaging	0.75
R5642:Tpr	UTSW	1	150423818	missense	probably damaging	0.99
R5779:Tpr	UTSW	1	150423541	missense	probably damaging	1.00
R5787:Tpr	UTSW	1	150395286	missense	probably benign	0.01
R5892:Tpr	UTSW	1	150407400	missense	probably benign	0.44
R5915:Tpr	UTSW	1	150425649	missense	probably benign	0.15
R5928:Tpr	UTSW	1	150428127	missense	probably benign	0.30
R6146:Tpr	UTSW	1	150423162	missense	possibly damaging	0.83
R6154:Tpr	UTSW	1	150423816	missense	probably benign	0.00
R6234:Tpr	UTSW	1	150418039	missense	probably benign	0.02
R6263:Tpr	UTSW	1	150442245	critical splice donor site	probably null
R6318:Tpr	UTSW	1	150445888	missense	possibly damaging	0.93
R6550:Tpr	UTSW	1	150423977	missense	probably damaging	1.00
R6592:Tpr	UTSW	1	150411905	missense	possibly damaging	0.83
R6704:Tpr	UTSW	1	150406508	missense	possibly damaging	0.80
R6716:Tpr	UTSW	1	150414765	missense	probably damaging	1.00
R6836:Tpr	UTSW	1	150436673	splice site	probably null
R6886:Tpr	UTSW	1	150423965	missense	probably benign	0.00
R6894:Tpr	UTSW	1	150436847	missense	probably benign	0.28
R6928:Tpr	UTSW	1	150408785	missense	possibly damaging	0.83
R7011:Tpr	UTSW	1	150433772	missense	probably damaging	1.00
R7034:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7036:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7183:Tpr	UTSW	1	150406551	missense	probably damaging	1.00
R7221:Tpr	UTSW	1	150446178	missense	possibly damaging	0.96
R7223:Tpr	UTSW	1	150439256	missense	possibly damaging	0.53
R7294:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R7343:Tpr	UTSW	1	150393494	missense	unknown
R7361:Tpr	UTSW	1	150447621	missense	possibly damaging	0.73
R7405:Tpr	UTSW	1	150442127	missense	probably benign	0.02
R7637:Tpr	UTSW	1	150423516	missense	probably damaging	1.00
R7720:Tpr	UTSW	1	150429532	missense	possibly damaging	0.49
R7721:Tpr	UTSW	1	150444429	missense	probably benign
R7751:Tpr	UTSW	1	150419895	missense	probably benign	0.17
R7804:Tpr	UTSW	1	150432559	missense	probably damaging	0.99
R7878:Tpr	UTSW	1	150423660	missense	possibly damaging	0.67
R7973:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R8013:Tpr	UTSW	1	150398608	missense	probably benign
R8220:Tpr	UTSW	1	150432413	missense	probably benign	0.05
R8274:Tpr	UTSW	1	150423479	splice site	probably benign
R8428:Tpr	UTSW	1	150414813	missense	probably damaging	1.00
R8482:Tpr	UTSW	1	150433700	missense	probably damaging	1.00
R8699:Tpr	UTSW	1	150418021	missense	probably damaging	0.99
R8859:Tpr	UTSW	1	150408846	missense	possibly damaging	0.90
R9119:Tpr	UTSW	1	150404002	missense	probably damaging	0.99
R9326:Tpr	UTSW	1	150425656	missense	possibly damaging	0.86
R9618:Tpr	UTSW	1	150446228	missense	possibly damaging	0.70
R9680:Tpr	UTSW	1	150439136	missense	probably benign	0.32
R9776:Tpr	UTSW	1	150449188	missense	probably benign	0.00
X0021:Tpr	UTSW	1	150395207	missense	probably damaging	1.00
Z1177:Tpr	UTSW	1	150428235	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGCATCACAAAGCATTCAGTCTGC -3'
(R):5'- ATCAGTGCGATGTGGCACCACAAG -3'

Sequencing Primer
(F):5'- GCATTCAGTCTGCCAATTCAAG -3'
(R):5'- TGTGGCACCACAAGAGTTG -3'

Posted On

2013-05-09