Incidental Mutation 'R0219:Fcer1g'
ID33702
Institutional Source Beutler Lab
Gene Symbol Fcer1g
Ensembl Gene ENSMUSG00000058715
Gene NameFc receptor, IgE, high affinity I, gamma polypeptide
SynonymsFcepsilonRI, FcR[g], FcR-gamma, FcRgamma, Fce1g, Ly-50
MMRRC Submission 038468-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R0219 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171229572-171234365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171231226 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 31 (V31A)
Ref Sequence ENSEMBL: ENSMUSP00000141240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005824] [ENSMUST00000013737] [ENSMUST00000079957] [ENSMUST00000111318] [ENSMUST00000111319] [ENSMUST00000111320] [ENSMUST00000111321] [ENSMUST00000193973]
Predicted Effect probably benign
Transcript: ENSMUST00000005824
SMART Domains Protein: ENSMUSP00000005824
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000013737
SMART Domains Protein: ENSMUSP00000013737
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 463 1.1e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079957
AA Change: V31A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078875
Gene: ENSMUSG00000058715
AA Change: V31A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 51 3.7e-19 PFAM
ITAM 62 82 9.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111318
SMART Domains Protein: ENSMUSP00000106950
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 236 2e-21 PFAM
Pfam:Complex1_49kDa 232 437 1.7e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111319
SMART Domains Protein: ENSMUSP00000106951
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 98 2.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111320
SMART Domains Protein: ENSMUSP00000106952
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111321
SMART Domains Protein: ENSMUSP00000106953
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150997
Predicted Effect possibly damaging
Transcript: ENSMUST00000193973
AA Change: V31A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141240
Gene: ENSMUSG00000058715
AA Change: V31A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 53 4.7e-19 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The high affinity IgE receptor is a key molecule involved in allergic reactions. It is a tetramer composed of 1 alpha, 1 beta, and 2 gamma chains. The gamma chains are also subunits of other Fc receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in macrophage phagocytosis, NK cell-mediated antibody-coated cytotoxicity, mast cell degranulation, IgE-mediated systemic anaphylaxis, and neutrophil recruitment and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,886,150 probably benign Het
Acacb T A 5: 114,232,944 M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,811,040 probably benign Het
Ankle2 C T 5: 110,251,645 R624* probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Brca2 A G 5: 150,523,175 probably benign Het
Ccdc116 T A 16: 17,141,612 R404S possibly damaging Het
Ccdc171 A G 4: 83,696,441 probably benign Het
Ccdc80 A G 16: 45,096,483 K534R probably damaging Het
Ccna1 T C 3: 55,050,927 I112V probably benign Het
Cdhr1 A C 14: 37,079,601 L795R possibly damaging Het
Cilp C A 9: 65,269,590 L43I possibly damaging Het
Dclk2 T C 3: 86,813,669 probably benign Het
Ddx59 C A 1: 136,432,309 probably benign Het
Dgkd T C 1: 87,938,274 probably benign Het
Dicer1 A G 12: 104,692,125 probably null Het
Dst T G 1: 34,303,478 S5030A probably damaging Het
Dysf G A 6: 84,129,461 probably benign Het
Farp1 C A 14: 121,243,600 P471Q possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Glb1l2 A G 9: 26,806,322 V21A probably benign Het
Gm9912 T C 3: 149,185,495 I1V unknown Het
Guf1 G A 5: 69,559,586 A164T probably damaging Het
Hbb-bs T C 7: 103,826,669 H147R possibly damaging Het
Hnrnpr T A 4: 136,339,163 probably benign Het
Iglon5 A T 7: 43,476,837 V214E probably damaging Het
Isx C A 8: 74,889,961 probably null Het
Kank4 T C 4: 98,778,465 N582D probably benign Het
Kcp T A 6: 29,495,785 R773W probably damaging Het
Kdm4c T C 4: 74,373,620 C825R probably damaging Het
Krt25 G A 11: 99,318,059 T315M probably benign Het
Lrp5 A T 19: 3,597,349 S1298T probably damaging Het
Map3k10 T C 7: 27,656,731 D921G probably damaging Het
Mrgprx1 C A 7: 48,021,546 W151L probably damaging Het
Mylk3 T A 8: 85,355,244 D375V probably damaging Het
Nav3 C T 10: 109,866,930 probably null Het
Ncan A G 8: 70,115,334 S43P probably benign Het
Necab3 G T 2: 154,546,093 Q292K probably benign Het
Nptx2 T C 5: 144,548,140 S148P probably damaging Het
Olfr414 G A 1: 174,430,466 V13I probably benign Het
Olfr520 A T 7: 99,735,928 I262L probably benign Het
Pde6a A G 18: 61,285,935 E794G possibly damaging Het
Pus7 T C 5: 23,775,966 Y133C possibly damaging Het
Rad21l A G 2: 151,654,588 probably benign Het
Rptor A T 11: 119,821,777 probably benign Het
Sart1 C A 19: 5,388,396 A78S probably benign Het
Shkbp1 T C 7: 27,352,061 E191G probably benign Het
Slc6a18 A T 13: 73,674,632 probably null Het
Stxbp5 T C 10: 9,770,528 T147A probably benign Het
Sv2b A G 7: 75,157,267 probably null Het
Syne2 A T 12: 76,042,004 K5045N probably damaging Het
Tmem174 A C 13: 98,636,839 M161R possibly damaging Het
Tmprss7 A G 16: 45,656,457 V814A probably damaging Het
Togaram2 T C 17: 71,714,230 probably benign Het
Tpr T C 1: 150,443,258 probably null Het
Ttn T C 2: 76,900,228 probably benign Het
Ubr4 T A 4: 139,430,257 L2375Q possibly damaging Het
Utp20 T C 10: 88,764,675 E1987G probably damaging Het
Utrn T C 10: 12,684,451 T1365A probably damaging Het
Vmn2r116 T A 17: 23,386,098 Y128* probably null Het
Vmn2r5 A G 3: 64,504,313 V278A probably damaging Het
Vps13d C T 4: 145,105,909 S2809N probably benign Het
Zfp212 G A 6: 47,926,685 R68H probably damaging Het
Zfp442 A T 2: 150,411,240 L33Q probably damaging Het
Zfp629 T C 7: 127,612,083 S185G probably damaging Het
Zfp738 A G 13: 67,683,389 probably benign Het
Other mutations in Fcer1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02068:Fcer1g APN 1 171231191 missense probably damaging 1.00
R0734:Fcer1g UTSW 1 171231179 nonsense probably null
R4456:Fcer1g UTSW 1 171234239 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCTGCCTTTCGGACCTGGAT -3'
(R):5'- GTTTCTTCCCTTAGAAGGCTGCCAT -3'

Sequencing Primer
(F):5'- TCTGGAGTGGGGAAAAGGAAATC -3'
(R):5'- agaaagaaagaaagagagagagagag -3'
Posted On2013-05-09