Incidental Mutation 'R0219:Necab3'
ID33707
Institutional Source Beutler Lab
Gene Symbol Necab3
Ensembl Gene ENSMUSG00000027489
Gene NameN-terminal EF-hand calcium binding protein 3
SynonymsApba2bp, XB51, 2900010M17Rik, Nip1
MMRRC Submission 038468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0219 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154544399-154558890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 154546093 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 292 (Q292K)
Ref Sequence ENSEMBL: ENSMUSP00000000895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000895] [ENSMUST00000045116] [ENSMUST00000109709] [ENSMUST00000109716] [ENSMUST00000125793]
Predicted Effect probably benign
Transcript: ENSMUST00000000895
AA Change: Q292K

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000000895
Gene: ENSMUSG00000027489
AA Change: Q292K

DomainStartEndE-ValueType
Pfam:EF-hand_1 31 58 7.3e-8 PFAM
Pfam:EF-hand_5 32 57 4.6e-9 PFAM
low complexity region 180 203 N/A INTRINSIC
coiled coil region 209 237 N/A INTRINSIC
Pfam:ABM 252 327 4.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045116
SMART Domains Protein: ENSMUSP00000035523
Gene: ENSMUSG00000038523

DomainStartEndE-ValueType
Pfam:Bclt 1 194 2.1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109709
SMART Domains Protein: ENSMUSP00000105331
Gene: ENSMUSG00000038523

DomainStartEndE-ValueType
Pfam:Bclt 1 207 1.9e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109716
AA Change: Q268K

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105338
Gene: ENSMUSG00000027489
AA Change: Q268K

DomainStartEndE-ValueType
Pfam:EF-hand_1 31 59 6.9e-8 PFAM
Pfam:EF-hand_5 32 57 1.7e-9 PFAM
low complexity region 180 203 N/A INTRINSIC
Pfam:ABM 232 303 2.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124382
Predicted Effect probably benign
Transcript: ENSMUST00000125793
SMART Domains Protein: ENSMUSP00000117090
Gene: ENSMUSG00000027489

DomainStartEndE-ValueType
low complexity region 146 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135641
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the amino-terminal domain of the neuron-specific X11-like protein (X11L), inhibits the association of X11L with amyloid precursor protein through a non-competitive mechanism, and abolishes the suppression of beta-amyloid production by X11L. This protein, together with X11L, may play an important role in the regulatory system of amyloid precursor protein metabolism and beta-amyloid generation. The protein is phosphorylated by NIMA-related expressed kinase 2, and localizes to the Golgi apparatus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,886,150 probably benign Het
Acacb T A 5: 114,232,944 M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,811,040 probably benign Het
Ankle2 C T 5: 110,251,645 R624* probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Brca2 A G 5: 150,523,175 probably benign Het
Ccdc116 T A 16: 17,141,612 R404S possibly damaging Het
Ccdc171 A G 4: 83,696,441 probably benign Het
Ccdc80 A G 16: 45,096,483 K534R probably damaging Het
Ccna1 T C 3: 55,050,927 I112V probably benign Het
Cdhr1 A C 14: 37,079,601 L795R possibly damaging Het
Cilp C A 9: 65,269,590 L43I possibly damaging Het
Dclk2 T C 3: 86,813,669 probably benign Het
Ddx59 C A 1: 136,432,309 probably benign Het
Dgkd T C 1: 87,938,274 probably benign Het
Dicer1 A G 12: 104,692,125 probably null Het
Dst T G 1: 34,303,478 S5030A probably damaging Het
Dysf G A 6: 84,129,461 probably benign Het
Farp1 C A 14: 121,243,600 P471Q possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer1g A G 1: 171,231,226 V31A possibly damaging Het
Glb1l2 A G 9: 26,806,322 V21A probably benign Het
Gm9912 T C 3: 149,185,495 I1V unknown Het
Guf1 G A 5: 69,559,586 A164T probably damaging Het
Hbb-bs T C 7: 103,826,669 H147R possibly damaging Het
Hnrnpr T A 4: 136,339,163 probably benign Het
Iglon5 A T 7: 43,476,837 V214E probably damaging Het
Isx C A 8: 74,889,961 probably null Het
Kank4 T C 4: 98,778,465 N582D probably benign Het
Kcp T A 6: 29,495,785 R773W probably damaging Het
Kdm4c T C 4: 74,373,620 C825R probably damaging Het
Krt25 G A 11: 99,318,059 T315M probably benign Het
Lrp5 A T 19: 3,597,349 S1298T probably damaging Het
Map3k10 T C 7: 27,656,731 D921G probably damaging Het
Mrgprx1 C A 7: 48,021,546 W151L probably damaging Het
Mylk3 T A 8: 85,355,244 D375V probably damaging Het
Nav3 C T 10: 109,866,930 probably null Het
Ncan A G 8: 70,115,334 S43P probably benign Het
Nptx2 T C 5: 144,548,140 S148P probably damaging Het
Olfr414 G A 1: 174,430,466 V13I probably benign Het
Olfr520 A T 7: 99,735,928 I262L probably benign Het
Pde6a A G 18: 61,285,935 E794G possibly damaging Het
Pus7 T C 5: 23,775,966 Y133C possibly damaging Het
Rad21l A G 2: 151,654,588 probably benign Het
Rptor A T 11: 119,821,777 probably benign Het
Sart1 C A 19: 5,388,396 A78S probably benign Het
Shkbp1 T C 7: 27,352,061 E191G probably benign Het
Slc6a18 A T 13: 73,674,632 probably null Het
Stxbp5 T C 10: 9,770,528 T147A probably benign Het
Sv2b A G 7: 75,157,267 probably null Het
Syne2 A T 12: 76,042,004 K5045N probably damaging Het
Tmem174 A C 13: 98,636,839 M161R possibly damaging Het
Tmprss7 A G 16: 45,656,457 V814A probably damaging Het
Togaram2 T C 17: 71,714,230 probably benign Het
Tpr T C 1: 150,443,258 probably null Het
Ttn T C 2: 76,900,228 probably benign Het
Ubr4 T A 4: 139,430,257 L2375Q possibly damaging Het
Utp20 T C 10: 88,764,675 E1987G probably damaging Het
Utrn T C 10: 12,684,451 T1365A probably damaging Het
Vmn2r116 T A 17: 23,386,098 Y128* probably null Het
Vmn2r5 A G 3: 64,504,313 V278A probably damaging Het
Vps13d C T 4: 145,105,909 S2809N probably benign Het
Zfp212 G A 6: 47,926,685 R68H probably damaging Het
Zfp442 A T 2: 150,411,240 L33Q probably damaging Het
Zfp629 T C 7: 127,612,083 S185G probably damaging Het
Zfp738 A G 13: 67,683,389 probably benign Het
Other mutations in Necab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Necab3 APN 2 154547568 unclassified probably benign
IGL01515:Necab3 APN 2 154554691 missense probably damaging 1.00
IGL02438:Necab3 APN 2 154546044 missense probably damaging 1.00
IGL03150:Necab3 APN 2 154554742 missense probably damaging 1.00
R0092:Necab3 UTSW 2 154558739 missense possibly damaging 0.89
R0102:Necab3 UTSW 2 154545312 missense probably damaging 1.00
R0102:Necab3 UTSW 2 154545312 missense probably damaging 1.00
R0656:Necab3 UTSW 2 154546303 missense probably null 0.28
R1728:Necab3 UTSW 2 154546875 missense probably benign 0.09
R1729:Necab3 UTSW 2 154546875 missense probably benign 0.09
R2192:Necab3 UTSW 2 154547079 missense possibly damaging 0.62
R4622:Necab3 UTSW 2 154555582 critical splice donor site probably null
R5434:Necab3 UTSW 2 154547459 missense probably damaging 1.00
R5577:Necab3 UTSW 2 154545156 unclassified probably null
R6603:Necab3 UTSW 2 154554922 missense probably damaging 1.00
R7792:Necab3 UTSW 2 154546280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGCTACTGCCAGGACTAAATG -3'
(R):5'- TGCTGCTACATGAACTTCACAGGG -3'

Sequencing Primer
(F):5'- atcctcctgcctctgcc -3'
(R):5'- GGCCCAAAGCCATTGTCTG -3'
Posted On2013-05-09