Incidental Mutation 'R0219:Acacb'
ID 33719
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 038468-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0219 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114371005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1749 (M1749K)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect possibly damaging
Transcript: ENSMUST00000031583
AA Change: M1749K

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: M1749K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102582
AA Change: M1749K

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: M1749K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Meta Mutation Damage Score 0.2122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,849,885 (GRCm39) probably benign Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,958,906 (GRCm39) probably benign Het
Ankle2 C T 5: 110,399,511 (GRCm39) R624* probably null Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Brca2 A G 5: 150,446,640 (GRCm39) probably benign Het
Ccdc116 T A 16: 16,959,476 (GRCm39) R404S possibly damaging Het
Ccdc171 A G 4: 83,614,678 (GRCm39) probably benign Het
Ccdc80 A G 16: 44,916,846 (GRCm39) K534R probably damaging Het
Ccna1 T C 3: 54,958,348 (GRCm39) I112V probably benign Het
Cdhr1 A C 14: 36,801,558 (GRCm39) L795R possibly damaging Het
Cilp C A 9: 65,176,872 (GRCm39) L43I possibly damaging Het
Dclk2 T C 3: 86,720,976 (GRCm39) probably benign Het
Ddx59 C A 1: 136,360,047 (GRCm39) probably benign Het
Dgkd T C 1: 87,865,996 (GRCm39) probably benign Het
Dicer1 A G 12: 104,658,384 (GRCm39) probably null Het
Dst T G 1: 34,342,559 (GRCm39) S5030A probably damaging Het
Dysf G A 6: 84,106,443 (GRCm39) probably benign Het
Farp1 C A 14: 121,481,012 (GRCm39) P471Q possibly damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Fcer1g A G 1: 171,058,795 (GRCm39) V31A possibly damaging Het
Glb1l2 A G 9: 26,717,618 (GRCm39) V21A probably benign Het
Gm9912 T C 3: 148,891,131 (GRCm39) I1V unknown Het
Guf1 G A 5: 69,716,929 (GRCm39) A164T probably damaging Het
Hbb-bs T C 7: 103,475,876 (GRCm39) H147R possibly damaging Het
Hnrnpr T A 4: 136,066,474 (GRCm39) probably benign Het
Iglon5 A T 7: 43,126,261 (GRCm39) V214E probably damaging Het
Isx C A 8: 75,616,589 (GRCm39) probably null Het
Kank4 T C 4: 98,666,702 (GRCm39) N582D probably benign Het
Kcp T A 6: 29,495,784 (GRCm39) R773W probably damaging Het
Kdm4c T C 4: 74,291,857 (GRCm39) C825R probably damaging Het
Krt25 G A 11: 99,208,885 (GRCm39) T315M probably benign Het
Lrp5 A T 19: 3,647,349 (GRCm39) S1298T probably damaging Het
Map3k10 T C 7: 27,356,156 (GRCm39) D921G probably damaging Het
Mrgprx1 C A 7: 47,671,294 (GRCm39) W151L probably damaging Het
Mylk3 T A 8: 86,081,873 (GRCm39) D375V probably damaging Het
Nav3 C T 10: 109,702,791 (GRCm39) probably null Het
Ncan A G 8: 70,567,984 (GRCm39) S43P probably benign Het
Necab3 G T 2: 154,388,013 (GRCm39) Q292K probably benign Het
Nptx2 T C 5: 144,484,950 (GRCm39) S148P probably damaging Het
Or2at4 A T 7: 99,385,135 (GRCm39) I262L probably benign Het
Or6p1 G A 1: 174,258,032 (GRCm39) V13I probably benign Het
Pde6a A G 18: 61,419,006 (GRCm39) E794G possibly damaging Het
Pus7 T C 5: 23,980,964 (GRCm39) Y133C possibly damaging Het
Rad21l A G 2: 151,496,508 (GRCm39) probably benign Het
Rptor A T 11: 119,712,603 (GRCm39) probably benign Het
Sart1 C A 19: 5,438,424 (GRCm39) A78S probably benign Het
Shkbp1 T C 7: 27,051,486 (GRCm39) E191G probably benign Het
Slc6a18 A T 13: 73,822,751 (GRCm39) probably null Het
Stxbp5 T C 10: 9,646,272 (GRCm39) T147A probably benign Het
Sv2b A G 7: 74,807,015 (GRCm39) probably null Het
Syne2 A T 12: 76,088,778 (GRCm39) K5045N probably damaging Het
Tmem174 A C 13: 98,773,347 (GRCm39) M161R possibly damaging Het
Tmprss7 A G 16: 45,476,820 (GRCm39) V814A probably damaging Het
Togaram2 T C 17: 72,021,225 (GRCm39) probably benign Het
Tpr T C 1: 150,319,009 (GRCm39) probably null Het
Ttn T C 2: 76,730,572 (GRCm39) probably benign Het
Ubr4 T A 4: 139,157,568 (GRCm39) L2375Q possibly damaging Het
Utp20 T C 10: 88,600,537 (GRCm39) E1987G probably damaging Het
Utrn T C 10: 12,560,195 (GRCm39) T1365A probably damaging Het
Vmn2r116 T A 17: 23,605,072 (GRCm39) Y128* probably null Het
Vmn2r5 A G 3: 64,411,734 (GRCm39) V278A probably damaging Het
Vps13d C T 4: 144,832,479 (GRCm39) S2809N probably benign Het
Zfp212 G A 6: 47,903,619 (GRCm39) R68H probably damaging Het
Zfp442 A T 2: 150,253,160 (GRCm39) L33Q probably damaging Het
Zfp629 T C 7: 127,211,255 (GRCm39) S185G probably damaging Het
Zfp738 A G 13: 67,831,508 (GRCm39) probably benign Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGATTGAAGACCTGGCACTCTGAC -3'
(R):5'- CCCTATGCCGAAAGAGCCGATTTG -3'

Sequencing Primer
(F):5'- CATGTCACCTCCAACCAGGAAG -3'
(R):5'- GTCCCGGCCTTCTGGATAC -3'
Posted On 2013-05-09