Incidental Mutation 'R0219:Utrn'
ID33736
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Nameutrophin
SynonymsG-utrophin, DRP, Dmdl
MMRRC Submission 038468-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0219 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location12382188-12869365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12684451 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1365 (T1365A)
Ref Sequence ENSEMBL: ENSMUSP00000151431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
Predicted Effect probably damaging
Transcript: ENSMUST00000076817
AA Change: T1365A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: T1365A

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218635
AA Change: T1365A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219724
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,886,150 probably benign Het
Acacb T A 5: 114,232,944 M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,811,040 probably benign Het
Ankle2 C T 5: 110,251,645 R624* probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Brca2 A G 5: 150,523,175 probably benign Het
Ccdc116 T A 16: 17,141,612 R404S possibly damaging Het
Ccdc171 A G 4: 83,696,441 probably benign Het
Ccdc80 A G 16: 45,096,483 K534R probably damaging Het
Ccna1 T C 3: 55,050,927 I112V probably benign Het
Cdhr1 A C 14: 37,079,601 L795R possibly damaging Het
Cilp C A 9: 65,269,590 L43I possibly damaging Het
Dclk2 T C 3: 86,813,669 probably benign Het
Ddx59 C A 1: 136,432,309 probably benign Het
Dgkd T C 1: 87,938,274 probably benign Het
Dicer1 A G 12: 104,692,125 probably null Het
Dst T G 1: 34,303,478 S5030A probably damaging Het
Dysf G A 6: 84,129,461 probably benign Het
Farp1 C A 14: 121,243,600 P471Q possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer1g A G 1: 171,231,226 V31A possibly damaging Het
Glb1l2 A G 9: 26,806,322 V21A probably benign Het
Gm9912 T C 3: 149,185,495 I1V unknown Het
Guf1 G A 5: 69,559,586 A164T probably damaging Het
Hbb-bs T C 7: 103,826,669 H147R possibly damaging Het
Hnrnpr T A 4: 136,339,163 probably benign Het
Iglon5 A T 7: 43,476,837 V214E probably damaging Het
Isx C A 8: 74,889,961 probably null Het
Kank4 T C 4: 98,778,465 N582D probably benign Het
Kcp T A 6: 29,495,785 R773W probably damaging Het
Kdm4c T C 4: 74,373,620 C825R probably damaging Het
Krt25 G A 11: 99,318,059 T315M probably benign Het
Lrp5 A T 19: 3,597,349 S1298T probably damaging Het
Map3k10 T C 7: 27,656,731 D921G probably damaging Het
Mrgprx1 C A 7: 48,021,546 W151L probably damaging Het
Mylk3 T A 8: 85,355,244 D375V probably damaging Het
Nav3 C T 10: 109,866,930 probably null Het
Ncan A G 8: 70,115,334 S43P probably benign Het
Necab3 G T 2: 154,546,093 Q292K probably benign Het
Nptx2 T C 5: 144,548,140 S148P probably damaging Het
Olfr414 G A 1: 174,430,466 V13I probably benign Het
Olfr520 A T 7: 99,735,928 I262L probably benign Het
Pde6a A G 18: 61,285,935 E794G possibly damaging Het
Pus7 T C 5: 23,775,966 Y133C possibly damaging Het
Rad21l A G 2: 151,654,588 probably benign Het
Rptor A T 11: 119,821,777 probably benign Het
Sart1 C A 19: 5,388,396 A78S probably benign Het
Shkbp1 T C 7: 27,352,061 E191G probably benign Het
Slc6a18 A T 13: 73,674,632 probably null Het
Stxbp5 T C 10: 9,770,528 T147A probably benign Het
Sv2b A G 7: 75,157,267 probably null Het
Syne2 A T 12: 76,042,004 K5045N probably damaging Het
Tmem174 A C 13: 98,636,839 M161R possibly damaging Het
Tmprss7 A G 16: 45,656,457 V814A probably damaging Het
Togaram2 T C 17: 71,714,230 probably benign Het
Tpr T C 1: 150,443,258 probably null Het
Ttn T C 2: 76,900,228 probably benign Het
Ubr4 T A 4: 139,430,257 L2375Q possibly damaging Het
Utp20 T C 10: 88,764,675 E1987G probably damaging Het
Vmn2r116 T A 17: 23,386,098 Y128* probably null Het
Vmn2r5 A G 3: 64,504,313 V278A probably damaging Het
Vps13d C T 4: 145,105,909 S2809N probably benign Het
Zfp212 G A 6: 47,926,685 R68H probably damaging Het
Zfp442 A T 2: 150,411,240 L33Q probably damaging Het
Zfp629 T C 7: 127,612,083 S185G probably damaging Het
Zfp738 A G 13: 67,683,389 probably benign Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
retiring UTSW 10 12641020 missense probably damaging 1.00
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12666704 missense probably benign 0.06
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
R7037:Utrn UTSW 10 12826770 splice site probably null
R7038:Utrn UTSW 10 12682338 missense probably damaging 1.00
R7055:Utrn UTSW 10 12747921 missense probably benign 0.23
R7072:Utrn UTSW 10 12465213 missense probably damaging 1.00
R7090:Utrn UTSW 10 12684516 missense possibly damaging 0.58
R7211:Utrn UTSW 10 12401335 missense possibly damaging 0.72
R7248:Utrn UTSW 10 12728818 missense possibly damaging 0.51
R7305:Utrn UTSW 10 12385536 missense probably benign
R7334:Utrn UTSW 10 12728009 intron probably null
R7348:Utrn UTSW 10 12748018 missense probably damaging 1.00
R7375:Utrn UTSW 10 12641020 missense probably damaging 1.00
R7436:Utrn UTSW 10 12439791 missense possibly damaging 0.72
R7476:Utrn UTSW 10 12640951 missense probably benign
R7514:Utrn UTSW 10 12698089 missense probably benign 0.00
R7527:Utrn UTSW 10 12401382 missense possibly damaging 0.81
R7735:Utrn UTSW 10 12744043 critical splice donor site probably null
R7748:Utrn UTSW 10 12614508 missense probably benign 0.01
R7778:Utrn UTSW 10 12486610 missense probably damaging 1.00
R7824:Utrn UTSW 10 12486610 missense probably damaging 1.00
RF009:Utrn UTSW 10 12633945 nonsense probably null
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCAAGTTCTCACACAAGGAACAA -3'
(R):5'- GCTGCTGTGTCCATGAGATACTAGAAG -3'

Sequencing Primer
(F):5'- GTTCTCACACAAGGAACAAGAACAG -3'
(R):5'- AGAGCTACAGTCTTGAACCAG -3'
Posted On2013-05-09