Incidental Mutation 'R0219:Slc6a18'
ID 33746
Institutional Source Beutler Lab
Gene Symbol Slc6a18
Ensembl Gene ENSMUSG00000021612
Gene Name solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms XT2, D630001K16Rik, Xtrp2
MMRRC Submission 038468-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0219 (G1)
Quality Score 200
Status Validated
Chromosome 13
Chromosomal Location 73809871-73826142 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 73822751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022105] [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000221026] [ENSMUST00000221987] [ENSMUST00000222029] [ENSMUST00000223074] [ENSMUST00000223026]
AlphaFold O88576
Predicted Effect probably null
Transcript: ENSMUST00000022105
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000022105
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109679
SMART Domains Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612

DomainStartEndE-ValueType
Pfam:SNF 17 511 6.8e-164 PFAM
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109680
SMART Domains Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612

DomainStartEndE-ValueType
Pfam:SNF 17 325 2.1e-126 PFAM
Pfam:SNF 392 555 9.1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000220650
Predicted Effect probably null
Transcript: ENSMUST00000221026
Predicted Effect probably benign
Transcript: ENSMUST00000221987
AA Change: V146E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably null
Transcript: ENSMUST00000222029
Predicted Effect probably null
Transcript: ENSMUST00000223074
Predicted Effect probably benign
Transcript: ENSMUST00000223026
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,849,885 (GRCm39) probably benign Het
Acacb T A 5: 114,371,005 (GRCm39) M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,958,906 (GRCm39) probably benign Het
Ankle2 C T 5: 110,399,511 (GRCm39) R624* probably null Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Brca2 A G 5: 150,446,640 (GRCm39) probably benign Het
Ccdc116 T A 16: 16,959,476 (GRCm39) R404S possibly damaging Het
Ccdc171 A G 4: 83,614,678 (GRCm39) probably benign Het
Ccdc80 A G 16: 44,916,846 (GRCm39) K534R probably damaging Het
Ccna1 T C 3: 54,958,348 (GRCm39) I112V probably benign Het
Cdhr1 A C 14: 36,801,558 (GRCm39) L795R possibly damaging Het
Cilp C A 9: 65,176,872 (GRCm39) L43I possibly damaging Het
Dclk2 T C 3: 86,720,976 (GRCm39) probably benign Het
Ddx59 C A 1: 136,360,047 (GRCm39) probably benign Het
Dgkd T C 1: 87,865,996 (GRCm39) probably benign Het
Dicer1 A G 12: 104,658,384 (GRCm39) probably null Het
Dst T G 1: 34,342,559 (GRCm39) S5030A probably damaging Het
Dysf G A 6: 84,106,443 (GRCm39) probably benign Het
Farp1 C A 14: 121,481,012 (GRCm39) P471Q possibly damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Fcer1g A G 1: 171,058,795 (GRCm39) V31A possibly damaging Het
Glb1l2 A G 9: 26,717,618 (GRCm39) V21A probably benign Het
Gm9912 T C 3: 148,891,131 (GRCm39) I1V unknown Het
Guf1 G A 5: 69,716,929 (GRCm39) A164T probably damaging Het
Hbb-bs T C 7: 103,475,876 (GRCm39) H147R possibly damaging Het
Hnrnpr T A 4: 136,066,474 (GRCm39) probably benign Het
Iglon5 A T 7: 43,126,261 (GRCm39) V214E probably damaging Het
Isx C A 8: 75,616,589 (GRCm39) probably null Het
Kank4 T C 4: 98,666,702 (GRCm39) N582D probably benign Het
Kcp T A 6: 29,495,784 (GRCm39) R773W probably damaging Het
Kdm4c T C 4: 74,291,857 (GRCm39) C825R probably damaging Het
Krt25 G A 11: 99,208,885 (GRCm39) T315M probably benign Het
Lrp5 A T 19: 3,647,349 (GRCm39) S1298T probably damaging Het
Map3k10 T C 7: 27,356,156 (GRCm39) D921G probably damaging Het
Mrgprx1 C A 7: 47,671,294 (GRCm39) W151L probably damaging Het
Mylk3 T A 8: 86,081,873 (GRCm39) D375V probably damaging Het
Nav3 C T 10: 109,702,791 (GRCm39) probably null Het
Ncan A G 8: 70,567,984 (GRCm39) S43P probably benign Het
Necab3 G T 2: 154,388,013 (GRCm39) Q292K probably benign Het
Nptx2 T C 5: 144,484,950 (GRCm39) S148P probably damaging Het
Or2at4 A T 7: 99,385,135 (GRCm39) I262L probably benign Het
Or6p1 G A 1: 174,258,032 (GRCm39) V13I probably benign Het
Pde6a A G 18: 61,419,006 (GRCm39) E794G possibly damaging Het
Pus7 T C 5: 23,980,964 (GRCm39) Y133C possibly damaging Het
Rad21l A G 2: 151,496,508 (GRCm39) probably benign Het
Rptor A T 11: 119,712,603 (GRCm39) probably benign Het
Sart1 C A 19: 5,438,424 (GRCm39) A78S probably benign Het
Shkbp1 T C 7: 27,051,486 (GRCm39) E191G probably benign Het
Stxbp5 T C 10: 9,646,272 (GRCm39) T147A probably benign Het
Sv2b A G 7: 74,807,015 (GRCm39) probably null Het
Syne2 A T 12: 76,088,778 (GRCm39) K5045N probably damaging Het
Tmem174 A C 13: 98,773,347 (GRCm39) M161R possibly damaging Het
Tmprss7 A G 16: 45,476,820 (GRCm39) V814A probably damaging Het
Togaram2 T C 17: 72,021,225 (GRCm39) probably benign Het
Tpr T C 1: 150,319,009 (GRCm39) probably null Het
Ttn T C 2: 76,730,572 (GRCm39) probably benign Het
Ubr4 T A 4: 139,157,568 (GRCm39) L2375Q possibly damaging Het
Utp20 T C 10: 88,600,537 (GRCm39) E1987G probably damaging Het
Utrn T C 10: 12,560,195 (GRCm39) T1365A probably damaging Het
Vmn2r116 T A 17: 23,605,072 (GRCm39) Y128* probably null Het
Vmn2r5 A G 3: 64,411,734 (GRCm39) V278A probably damaging Het
Vps13d C T 4: 144,832,479 (GRCm39) S2809N probably benign Het
Zfp212 G A 6: 47,903,619 (GRCm39) R68H probably damaging Het
Zfp442 A T 2: 150,253,160 (GRCm39) L33Q probably damaging Het
Zfp629 T C 7: 127,211,255 (GRCm39) S185G probably damaging Het
Zfp738 A G 13: 67,831,508 (GRCm39) probably benign Het
Other mutations in Slc6a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Slc6a18 APN 13 73,819,838 (GRCm39) missense possibly damaging 0.82
IGL01370:Slc6a18 APN 13 73,815,150 (GRCm39) missense probably damaging 1.00
IGL01959:Slc6a18 APN 13 73,825,984 (GRCm39) missense probably damaging 1.00
IGL02096:Slc6a18 APN 13 73,820,870 (GRCm39) missense probably benign 0.05
IGL02147:Slc6a18 APN 13 73,816,281 (GRCm39) missense probably damaging 0.97
IGL02167:Slc6a18 APN 13 73,814,591 (GRCm39) critical splice acceptor site probably null
IGL02465:Slc6a18 APN 13 73,825,904 (GRCm39) missense probably benign 0.11
IGL02548:Slc6a18 APN 13 73,818,114 (GRCm39) missense probably damaging 1.00
IGL02720:Slc6a18 APN 13 73,818,087 (GRCm39) missense probably benign 0.16
IGL03341:Slc6a18 APN 13 73,826,042 (GRCm39) missense probably benign 0.07
R0011:Slc6a18 UTSW 13 73,813,738 (GRCm39) missense possibly damaging 0.59
R0884:Slc6a18 UTSW 13 73,815,156 (GRCm39) missense probably damaging 1.00
R1019:Slc6a18 UTSW 13 73,825,998 (GRCm39) missense probably damaging 1.00
R1610:Slc6a18 UTSW 13 73,816,344 (GRCm39) missense probably benign 0.10
R1901:Slc6a18 UTSW 13 73,818,162 (GRCm39) missense probably benign 0.39
R1969:Slc6a18 UTSW 13 73,812,308 (GRCm39) missense possibly damaging 0.66
R2014:Slc6a18 UTSW 13 73,823,844 (GRCm39) missense probably benign 0.02
R2445:Slc6a18 UTSW 13 73,814,871 (GRCm39) nonsense probably null
R2504:Slc6a18 UTSW 13 73,823,925 (GRCm39) missense probably benign 0.01
R3125:Slc6a18 UTSW 13 73,825,921 (GRCm39) missense probably damaging 1.00
R4084:Slc6a18 UTSW 13 73,815,148 (GRCm39) missense probably benign 0.39
R4571:Slc6a18 UTSW 13 73,814,489 (GRCm39) missense possibly damaging 0.59
R4735:Slc6a18 UTSW 13 73,814,554 (GRCm39) missense probably benign 0.42
R5032:Slc6a18 UTSW 13 73,814,442 (GRCm39) missense probably damaging 1.00
R5859:Slc6a18 UTSW 13 73,816,278 (GRCm39) missense probably benign 0.01
R6258:Slc6a18 UTSW 13 73,818,164 (GRCm39) nonsense probably null
R6350:Slc6a18 UTSW 13 73,826,044 (GRCm39) missense possibly damaging 0.80
R6370:Slc6a18 UTSW 13 73,816,278 (GRCm39) missense probably benign 0.21
R6640:Slc6a18 UTSW 13 73,812,401 (GRCm39) missense possibly damaging 0.95
R6747:Slc6a18 UTSW 13 73,826,110 (GRCm39) start gained probably benign
R7267:Slc6a18 UTSW 13 73,819,755 (GRCm39) missense probably damaging 1.00
R7702:Slc6a18 UTSW 13 73,820,915 (GRCm39) missense probably damaging 1.00
R8039:Slc6a18 UTSW 13 73,813,745 (GRCm39) missense probably benign 0.39
R8423:Slc6a18 UTSW 13 73,813,693 (GRCm39) missense probably benign 0.00
R8669:Slc6a18 UTSW 13 73,812,430 (GRCm39) missense probably benign 0.01
R8825:Slc6a18 UTSW 13 73,813,751 (GRCm39) missense probably null 0.01
R8993:Slc6a18 UTSW 13 73,816,390 (GRCm39) missense probably benign 0.01
R9023:Slc6a18 UTSW 13 73,823,889 (GRCm39) missense probably damaging 1.00
R9031:Slc6a18 UTSW 13 73,819,822 (GRCm39) missense possibly damaging 0.56
R9589:Slc6a18 UTSW 13 73,816,323 (GRCm39) missense possibly damaging 0.66
Z1177:Slc6a18 UTSW 13 73,825,979 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTCTCAATGCCTCTGATGACAC -3'
(R):5'- AGTCTCTTGCAGAGTCCTCCATCAC -3'

Sequencing Primer
(F):5'- TCTGATGACACACAGGTACACAG -3'
(R):5'- catacacacacacacacacac -3'
Posted On 2013-05-09